Incidental Mutation 'R5232:Pramel7'
ID 398582
Institutional Source Beutler Lab
Gene Symbol Pramel7
Ensembl Gene ENSMUSG00000025839
Gene Name preferentially expressed antigen in melanoma like 7
Synonyms
MMRRC Submission 042804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5232 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87489087-87497093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87489976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 324 (H324Q)
Ref Sequence ENSEMBL: ENSMUSP00000026957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026957]
AlphaFold Q810Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000026957
AA Change: H324Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026957
Gene: ENSMUSG00000025839
AA Change: H324Q

DomainStartEndE-ValueType
SCOP:d1a4ya_ 207 407 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148030
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,922 E1295G probably damaging Het
Adarb2 C A 13: 8,713,640 H524Q possibly damaging Het
Arhgap26 A G 18: 38,993,476 M1V probably null Het
Atp10b G A 11: 43,202,179 R447H probably damaging Het
B4galnt3 T A 6: 120,232,988 Y58F probably damaging Het
Cdca7l A G 12: 117,870,085 E79G probably damaging Het
Chd4 C G 6: 125,121,310 P350A probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Cubn A T 2: 13,478,202 C244* probably null Het
Cyfip2 A G 11: 46,242,378 S832P probably damaging Het
Dnaaf1 A C 8: 119,590,590 E286A probably benign Het
Emilin1 A G 5: 30,916,979 K188R probably benign Het
Fstl5 T C 3: 76,144,977 W5R possibly damaging Het
Gm5565 T A 5: 146,160,137 Y64F possibly damaging Het
Golga4 G A 9: 118,506,558 probably null Het
Hmcn2 T C 2: 31,457,748 L4802P probably damaging Het
Hnrnpll C T 17: 80,038,678 V385I probably damaging Het
Kctd9 A T 14: 67,724,661 D51V probably damaging Het
Lcn9 T C 2: 25,824,055 probably null Het
Map1a C A 2: 121,301,985 P856H probably damaging Het
Myo5b G C 18: 74,714,932 E1080D probably damaging Het
Naglu T C 11: 101,070,150 I9T probably benign Het
Ndst3 A T 3: 123,672,239 I28N probably damaging Het
Olfm4 A G 14: 80,021,682 N424D probably damaging Het
Olfr722 A G 14: 49,895,698 Y35H probably damaging Het
Olfr742 T A 14: 50,516,038 V278E probably damaging Het
Phf13 T C 4: 151,992,223 T171A probably damaging Het
Plk3 A G 4: 117,129,120 V605A probably benign Het
Polr3a A T 14: 24,453,211 M1185K probably benign Het
Prpf4b T A 13: 34,883,590 probably benign Het
Pxdn C T 12: 29,990,988 T421I probably benign Het
Sertad2 C T 11: 20,648,344 T180I possibly damaging Het
Sgo2b C A 8: 63,928,602 A399S possibly damaging Het
Skint5 T C 4: 113,577,644 K1043E unknown Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Spock3 T C 8: 63,345,809 F288S probably damaging Het
Srgap1 T C 10: 121,840,911 I393V probably benign Het
Taf6 T C 5: 138,179,952 K429R possibly damaging Het
Vav1 T C 17: 57,303,846 F447L possibly damaging Het
Vmn2r19 T C 6: 123,335,957 M662T probably benign Het
Zfp541 A G 7: 16,095,179 Y1152C probably damaging Het
Other mutations in Pramel7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Pramel7 APN 2 87491085 missense probably damaging 1.00
IGL01302:Pramel7 APN 2 87491373 missense possibly damaging 0.58
IGL01365:Pramel7 APN 2 87491413 splice site probably benign
IGL01728:Pramel7 APN 2 87491330 missense possibly damaging 0.95
IGL01769:Pramel7 APN 2 87489588 missense probably benign 0.09
IGL01932:Pramel7 APN 2 87491113 missense possibly damaging 0.80
IGL02971:Pramel7 APN 2 87490073 missense probably benign 0.03
IGL03376:Pramel7 APN 2 87489603 missense probably damaging 1.00
IGL03380:Pramel7 APN 2 87491372 missense probably benign 0.38
R0625:Pramel7 UTSW 2 87491008 missense probably benign 0.02
R1077:Pramel7 UTSW 2 87491190 missense probably damaging 1.00
R1455:Pramel7 UTSW 2 87489723 missense probably benign 0.00
R1666:Pramel7 UTSW 2 87492403 missense probably damaging 0.99
R1863:Pramel7 UTSW 2 87491331 missense probably benign 0.35
R1977:Pramel7 UTSW 2 87491121 missense probably benign 0.01
R2141:Pramel7 UTSW 2 87489977 missense probably damaging 1.00
R3027:Pramel7 UTSW 2 87491403 missense probably benign 0.01
R4374:Pramel7 UTSW 2 87490071 missense probably benign 0.05
R4735:Pramel7 UTSW 2 87490843 nonsense probably null
R6255:Pramel7 UTSW 2 87489663 missense probably benign 0.00
R6611:Pramel7 UTSW 2 87490049 missense probably damaging 1.00
R6898:Pramel7 UTSW 2 87489726 missense probably damaging 0.98
R7246:Pramel7 UTSW 2 87492165 missense probably damaging 1.00
R7293:Pramel7 UTSW 2 87492362 missense probably benign 0.28
R7408:Pramel7 UTSW 2 87490845 missense possibly damaging 0.89
R7431:Pramel7 UTSW 2 87489938 missense possibly damaging 0.65
R7469:Pramel7 UTSW 2 87491404 missense probably benign 0.01
R8300:Pramel7 UTSW 2 87489623 missense probably benign 0.01
R8803:Pramel7 UTSW 2 87490061 missense probably benign 0.00
R8940:Pramel7 UTSW 2 87491268 missense probably benign 0.03
R9281:Pramel7 UTSW 2 87491151 missense probably damaging 1.00
R9723:Pramel7 UTSW 2 87489675 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGTTCTCCAGGACATCCTCG -3'
(R):5'- TGTAGAATTAGCCAGACCCACC -3'

Sequencing Primer
(F):5'- CAGGACATCCTCGGAGATGTCATTG -3'
(R):5'- GTGATAACTTCAGCAAACCAACAGG -3'
Posted On 2016-07-06