Incidental Mutation 'R5232:Emilin1'
ID 398599
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Name elastin microfibril interfacer 1
Synonyms 5830419M17Rik, gp115, EMILIN-1
MMRRC Submission 042804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R5232 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30913402-30921277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30916979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 188 (K188R)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
AlphaFold Q99K41
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031055
AA Change: K188R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: K188R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166839
AA Change: R118G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,922 E1295G probably damaging Het
Adarb2 C A 13: 8,713,640 H524Q possibly damaging Het
Arhgap26 A G 18: 38,993,476 M1V probably null Het
Atp10b G A 11: 43,202,179 R447H probably damaging Het
B4galnt3 T A 6: 120,232,988 Y58F probably damaging Het
Cdca7l A G 12: 117,870,085 E79G probably damaging Het
Chd4 C G 6: 125,121,310 P350A probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Cubn A T 2: 13,478,202 C244* probably null Het
Cyfip2 A G 11: 46,242,378 S832P probably damaging Het
Dnaaf1 A C 8: 119,590,590 E286A probably benign Het
Fstl5 T C 3: 76,144,977 W5R possibly damaging Het
Gm5565 T A 5: 146,160,137 Y64F possibly damaging Het
Golga4 G A 9: 118,506,558 probably null Het
Hmcn2 T C 2: 31,457,748 L4802P probably damaging Het
Hnrnpll C T 17: 80,038,678 V385I probably damaging Het
Kctd9 A T 14: 67,724,661 D51V probably damaging Het
Lcn9 T C 2: 25,824,055 probably null Het
Map1a C A 2: 121,301,985 P856H probably damaging Het
Myo5b G C 18: 74,714,932 E1080D probably damaging Het
Naglu T C 11: 101,070,150 I9T probably benign Het
Ndst3 A T 3: 123,672,239 I28N probably damaging Het
Olfm4 A G 14: 80,021,682 N424D probably damaging Het
Olfr722 A G 14: 49,895,698 Y35H probably damaging Het
Olfr742 T A 14: 50,516,038 V278E probably damaging Het
Phf13 T C 4: 151,992,223 T171A probably damaging Het
Plk3 A G 4: 117,129,120 V605A probably benign Het
Polr3a A T 14: 24,453,211 M1185K probably benign Het
Pramel7 A T 2: 87,489,976 H324Q probably damaging Het
Prpf4b T A 13: 34,883,590 probably benign Het
Pxdn C T 12: 29,990,988 T421I probably benign Het
Sertad2 C T 11: 20,648,344 T180I possibly damaging Het
Sgo2b C A 8: 63,928,602 A399S possibly damaging Het
Skint5 T C 4: 113,577,644 K1043E unknown Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Spock3 T C 8: 63,345,809 F288S probably damaging Het
Srgap1 T C 10: 121,840,911 I393V probably benign Het
Taf6 T C 5: 138,179,952 K429R possibly damaging Het
Vav1 T C 17: 57,303,846 F447L possibly damaging Het
Vmn2r19 T C 6: 123,335,957 M662T probably benign Het
Zfp541 A G 7: 16,095,179 Y1152C probably damaging Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 30913902 missense probably damaging 0.97
IGL01100:Emilin1 APN 5 30918404 missense probably benign
IGL02150:Emilin1 APN 5 30920173 missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 30917788 missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 30920663 missense probably damaging 0.97
R0142:Emilin1 UTSW 5 30913920 missense probably benign 0.00
R0419:Emilin1 UTSW 5 30915022 missense probably damaging 1.00
R1580:Emilin1 UTSW 5 30917420 missense probably damaging 0.99
R1679:Emilin1 UTSW 5 30920199 missense probably benign 0.00
R1802:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1803:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 30918590 missense probably damaging 1.00
R1958:Emilin1 UTSW 5 30917816 missense probably benign 0.03
R2061:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2100:Emilin1 UTSW 5 30917897 missense probably benign 0.01
R2201:Emilin1 UTSW 5 30915692 missense probably benign 0.33
R2206:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 30918200 missense probably damaging 1.00
R2851:Emilin1 UTSW 5 30917165 missense probably benign 0.38
R3706:Emilin1 UTSW 5 30917822 missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 30919899 unclassified probably benign
R4865:Emilin1 UTSW 5 30917784 missense possibly damaging 0.93
R4878:Emilin1 UTSW 5 30917066 missense probably benign
R4981:Emilin1 UTSW 5 30919351 missense probably benign
R5113:Emilin1 UTSW 5 30920620 missense possibly damaging 0.73
R5853:Emilin1 UTSW 5 30918622 missense probably damaging 0.98
R6358:Emilin1 UTSW 5 30918218 missense probably damaging 0.98
R6807:Emilin1 UTSW 5 30915527 missense probably benign 0.10
R6932:Emilin1 UTSW 5 30917077 missense probably damaging 1.00
R6955:Emilin1 UTSW 5 30917909 missense probably damaging 1.00
R7047:Emilin1 UTSW 5 30917078 missense probably benign 0.05
R7278:Emilin1 UTSW 5 30920660 missense probably benign 0.32
R7305:Emilin1 UTSW 5 30917089 nonsense probably null
R8087:Emilin1 UTSW 5 30917100 missense probably damaging 1.00
R8208:Emilin1 UTSW 5 30917516 missense probably damaging 1.00
R8516:Emilin1 UTSW 5 30917171 missense probably damaging 1.00
R8686:Emilin1 UTSW 5 30917696 missense possibly damaging 0.85
R9224:Emilin1 UTSW 5 30917479 missense probably damaging 1.00
R9526:Emilin1 UTSW 5 30918140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCCAAATCATCCAAAGGAG -3'
(R):5'- TTGTTAAGGTGGCCCAGCTC -3'

Sequencing Primer
(F):5'- GAGAGCCTTCTGACCCTTGAC -3'
(R):5'- CTCCTGGTCATGAGTGGAGAC -3'
Posted On 2016-07-06