Mutagenetix > Incidental Mutation

Incidental Mutation 'R5232:Vmn2r19'

398604

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r19

Ensembl Gene

ENSMUSG00000091260

Gene Name

vomeronasal 2, receptor 19

Synonyms

EG232358

MMRRC Submission

042804-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R5232 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123308333-123336537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123335957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 662 (M662T)

Ref Sequence

ENSEMBL: ENSMUSP00000073604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073948]

AlphaFold

G5E8G4

Predicted Effect

probably benign
Transcript: ENSMUST00000073948
AA Change: M662T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: M662T

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:ANF_receptor	81	476	2.9e-35	PFAM
Pfam:NCD3G	518	571	8.3e-23	PFAM
Pfam:7tm_3	603	839	7.2e-52	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	T	C	16: 20,338,922	E1295G	probably damaging	Het
Adarb2	C	A	13: 8,713,640	H524Q	possibly damaging	Het
Arhgap26	A	G	18: 38,993,476	M1V	probably null	Het
Atp10b	G	A	11: 43,202,179	R447H	probably damaging	Het
B4galnt3	T	A	6: 120,232,988	Y58F	probably damaging	Het
Cdca7l	A	G	12: 117,870,085	E79G	probably damaging	Het
Chd4	C	G	6: 125,121,310	P350A	probably damaging	Het
Coq2	G	A	5: 100,657,832	H313Y	possibly damaging	Het
Cubn	A	T	2: 13,478,202	C244*	probably null	Het
Cyfip2	A	G	11: 46,242,378	S832P	probably damaging	Het
Dnaaf1	A	C	8: 119,590,590	E286A	probably benign	Het
Emilin1	A	G	5: 30,916,979	K188R	probably benign	Het
Fstl5	T	C	3: 76,144,977	W5R	possibly damaging	Het
Gm5565	T	A	5: 146,160,137	Y64F	possibly damaging	Het
Golga4	G	A	9: 118,506,558		probably null	Het
Hmcn2	T	C	2: 31,457,748	L4802P	probably damaging	Het
Hnrnpll	C	T	17: 80,038,678	V385I	probably damaging	Het
Kctd9	A	T	14: 67,724,661	D51V	probably damaging	Het
Lcn9	T	C	2: 25,824,055		probably null	Het
Map1a	C	A	2: 121,301,985	P856H	probably damaging	Het
Myo5b	G	C	18: 74,714,932	E1080D	probably damaging	Het
Naglu	T	C	11: 101,070,150	I9T	probably benign	Het
Ndst3	A	T	3: 123,672,239	I28N	probably damaging	Het
Olfm4	A	G	14: 80,021,682	N424D	probably damaging	Het
Olfr722	A	G	14: 49,895,698	Y35H	probably damaging	Het
Olfr742	T	A	14: 50,516,038	V278E	probably damaging	Het
Phf13	T	C	4: 151,992,223	T171A	probably damaging	Het
Plk3	A	G	4: 117,129,120	V605A	probably benign	Het
Polr3a	A	T	14: 24,453,211	M1185K	probably benign	Het
Pramel7	A	T	2: 87,489,976	H324Q	probably damaging	Het
Prpf4b	T	A	13: 34,883,590		probably benign	Het
Pxdn	C	T	12: 29,990,988	T421I	probably benign	Het
Sertad2	C	T	11: 20,648,344	T180I	possibly damaging	Het
Sgo2b	C	A	8: 63,928,602	A399S	possibly damaging	Het
Skint5	T	C	4: 113,577,644	K1043E	unknown	Het
Slc22a27	C	G	19: 7,865,938	A359P	probably damaging	Het
Spock3	T	C	8: 63,345,809	F288S	probably damaging	Het
Srgap1	T	C	10: 121,840,911	I393V	probably benign	Het
Taf6	T	C	5: 138,179,952	K429R	possibly damaging	Het
Vav1	T	C	17: 57,303,846	F447L	possibly damaging	Het
Zfp541	A	G	7: 16,095,179	Y1152C	probably damaging	Het

Other mutations in Vmn2r19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01407:Vmn2r19	APN	6	123329867	missense	possibly damaging	0.92
IGL02294:Vmn2r19	APN	6	123329978	missense	probably benign	0.19
IGL02442:Vmn2r19	APN	6	123309662	missense	possibly damaging	0.94
IGL02871:Vmn2r19	APN	6	123336083	missense	probably damaging	1.00
H8562:Vmn2r19	UTSW	6	123315902	missense	possibly damaging	0.82
R0025:Vmn2r19	UTSW	6	123331547	missense	probably benign	0.01
R0389:Vmn2r19	UTSW	6	123335986	missense	possibly damaging	0.53
R0402:Vmn2r19	UTSW	6	123336182	missense	probably damaging	1.00
R0411:Vmn2r19	UTSW	6	123309744	missense	probably damaging	0.98
R0554:Vmn2r19	UTSW	6	123336143	missense	probably damaging	0.99
R0578:Vmn2r19	UTSW	6	123335972	missense	probably damaging	1.00
R1102:Vmn2r19	UTSW	6	123336173	missense	probably benign	0.28
R1652:Vmn2r19	UTSW	6	123315697	missense	possibly damaging	0.68
R1663:Vmn2r19	UTSW	6	123336452	missense	probably benign	0.11
R1817:Vmn2r19	UTSW	6	123330052	missense	possibly damaging	0.80
R1866:Vmn2r19	UTSW	6	123331638	critical splice donor site	probably null
R1928:Vmn2r19	UTSW	6	123331630	missense	probably damaging	1.00
R1997:Vmn2r19	UTSW	6	123315921	missense	probably damaging	0.98
R2013:Vmn2r19	UTSW	6	123315995	missense	probably benign	0.01
R2015:Vmn2r19	UTSW	6	123315995	missense	probably benign	0.01
R2088:Vmn2r19	UTSW	6	123335836	missense	probably damaging	1.00
R2126:Vmn2r19	UTSW	6	123316074	missense	possibly damaging	0.82
R2128:Vmn2r19	UTSW	6	123308330	splice site	probably null
R2256:Vmn2r19	UTSW	6	123329886	missense	probably benign	0.20
R2517:Vmn2r19	UTSW	6	123329978	missense	probably benign	0.19
R3753:Vmn2r19	UTSW	6	123315589	missense	possibly damaging	0.80
R3817:Vmn2r19	UTSW	6	123309642	missense	probably damaging	1.00
R3929:Vmn2r19	UTSW	6	123315628	missense	probably benign	0.01
R3934:Vmn2r19	UTSW	6	123315669	missense	probably damaging	1.00
R4232:Vmn2r19	UTSW	6	123329912	missense	probably benign
R4574:Vmn2r19	UTSW	6	123315980	missense	probably benign	0.01
R4886:Vmn2r19	UTSW	6	123309841	missense	probably benign	0.05
R4995:Vmn2r19	UTSW	6	123329910	missense	probably benign	0.00
R5107:Vmn2r19	UTSW	6	123309643	nonsense	probably null
R6102:Vmn2r19	UTSW	6	123329948	missense	probably damaging	1.00
R6105:Vmn2r19	UTSW	6	123316095	missense	possibly damaging	0.70
R6280:Vmn2r19	UTSW	6	123336253	missense	probably benign
R6393:Vmn2r19	UTSW	6	123316153	missense	possibly damaging	0.80
R6502:Vmn2r19	UTSW	6	123316108	missense	possibly damaging	0.68
R6617:Vmn2r19	UTSW	6	123336535	makesense	probably null
R6742:Vmn2r19	UTSW	6	123329958	missense	possibly damaging	0.90
R7662:Vmn2r19	UTSW	6	123331562	missense	probably benign	0.33
R8041:Vmn2r19	UTSW	6	123335791	missense	possibly damaging	0.94
R8054:Vmn2r19	UTSW	6	123316039	missense	probably damaging	1.00
R8074:Vmn2r19	UTSW	6	123335945	missense	probably damaging	0.96
R8267:Vmn2r19	UTSW	6	123336262	missense	possibly damaging	0.50
R8287:Vmn2r19	UTSW	6	123331629	missense	probably damaging	1.00
R8937:Vmn2r19	UTSW	6	123316324	critical splice donor site	probably null
R9058:Vmn2r19	UTSW	6	123336062	missense	possibly damaging	0.53
R9119:Vmn2r19	UTSW	6	123315568	missense	possibly damaging	0.68
R9384:Vmn2r19	UTSW	6	123315964	missense	probably benign	0.00
X0058:Vmn2r19	UTSW	6	123308349	missense	probably benign	0.00
Z1088:Vmn2r19	UTSW	6	123308339	missense	probably benign	0.02
Z1177:Vmn2r19	UTSW	6	123336077	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCCCATGGAGATACTCTAGGAGC -3'
(R):5'- ATATGTCCCCAGCCAGACTG -3'

Sequencing Primer
(F):5'- AGATACTCTAGGAGCTGTTTTGG -3'
(R):5'- CAGCCAGACTGCACAGATG -3'

Posted On

2016-07-06