Incidental Mutation 'R5248:Kdm5b'
ID398608
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134620997 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1080 (E1080G)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
PDB Structure
Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000047714
AA Change: E1080G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: E1080G

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
AA Change: E1080G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: E1080G

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191572
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGAGTCATTGACCATGAGC -3'
(R):5'- CCCTGAGAACAGAGAGACTTATC -3'

Sequencing Primer
(F):5'- GAGTCATTGACCATGAGCTACACTG -3'
(R):5'- TGAGAACAGAGAGACTTATCTTACAC -3'
Posted On2016-07-06