Incidental Mutation 'R5232:Polr3a'
ID 398639
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 042804-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5232 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24503279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1185 (M1185K)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably benign
Transcript: ENSMUST00000026322
AA Change: M1185K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: M1185K

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,157,672 (GRCm39) E1295G probably damaging Het
Adarb2 C A 13: 8,763,676 (GRCm39) H524Q possibly damaging Het
Arhgap26 A G 18: 39,126,529 (GRCm39) M1V probably null Het
Atp10b G A 11: 43,093,006 (GRCm39) R447H probably damaging Het
B4galnt3 T A 6: 120,209,949 (GRCm39) Y58F probably damaging Het
Cdca7l A G 12: 117,833,820 (GRCm39) E79G probably damaging Het
Chd4 C G 6: 125,098,273 (GRCm39) P350A probably damaging Het
Coq2 G A 5: 100,805,698 (GRCm39) H313Y possibly damaging Het
Cubn A T 2: 13,483,013 (GRCm39) C244* probably null Het
Cyfip2 A G 11: 46,133,205 (GRCm39) S832P probably damaging Het
Dnaaf1 A C 8: 120,317,329 (GRCm39) E286A probably benign Het
Emilin1 A G 5: 31,074,323 (GRCm39) K188R probably benign Het
Fstl5 T C 3: 76,052,284 (GRCm39) W5R possibly damaging Het
Gm5565 T A 5: 146,096,947 (GRCm39) Y64F possibly damaging Het
Golga4 G A 9: 118,335,626 (GRCm39) probably null Het
Hmcn2 T C 2: 31,347,760 (GRCm39) L4802P probably damaging Het
Hnrnpll C T 17: 80,346,107 (GRCm39) V385I probably damaging Het
Kctd9 A T 14: 67,962,110 (GRCm39) D51V probably damaging Het
Lcn9 T C 2: 25,714,067 (GRCm39) probably null Het
Map1a C A 2: 121,132,466 (GRCm39) P856H probably damaging Het
Myo5b G C 18: 74,848,003 (GRCm39) E1080D probably damaging Het
Naglu T C 11: 100,960,976 (GRCm39) I9T probably benign Het
Ndst3 A T 3: 123,465,888 (GRCm39) I28N probably damaging Het
Olfm4 A G 14: 80,259,122 (GRCm39) N424D probably damaging Het
Or11g26 T A 14: 50,753,495 (GRCm39) V278E probably damaging Het
Or4n5 A G 14: 50,133,155 (GRCm39) Y35H probably damaging Het
Phf13 T C 4: 152,076,680 (GRCm39) T171A probably damaging Het
Plk3 A G 4: 116,986,317 (GRCm39) V605A probably benign Het
Pramel7 A T 2: 87,320,320 (GRCm39) H324Q probably damaging Het
Prpf4b T A 13: 35,067,573 (GRCm39) probably benign Het
Pxdn C T 12: 30,040,987 (GRCm39) T421I probably benign Het
Sertad2 C T 11: 20,598,344 (GRCm39) T180I possibly damaging Het
Sgo2b C A 8: 64,381,636 (GRCm39) A399S possibly damaging Het
Skint5 T C 4: 113,434,841 (GRCm39) K1043E unknown Het
Slc22a27 C G 19: 7,843,303 (GRCm39) A359P probably damaging Het
Spock3 T C 8: 63,798,843 (GRCm39) F288S probably damaging Het
Srgap1 T C 10: 121,676,816 (GRCm39) I393V probably benign Het
Taf6 T C 5: 138,178,214 (GRCm39) K429R possibly damaging Het
Vav1 T C 17: 57,610,846 (GRCm39) F447L possibly damaging Het
Vmn2r19 T C 6: 123,312,916 (GRCm39) M662T probably benign Het
Zfp541 A G 7: 15,829,104 (GRCm39) Y1152C probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGATTCTAAGAACCCACAGGC -3'
(R):5'- ACTTCTGCAGATGTCTGATGG -3'

Sequencing Primer
(F):5'- GATTCTAAGAACCCACAGGCAGAAAG -3'
(R):5'- ATGGTAATGTCCCTGGCAC -3'
Posted On 2016-07-06