Incidental Mutation 'R5232:Olfm4'
ID398647
Institutional Source Beutler Lab
Gene Symbol Olfm4
Ensembl Gene ENSMUSG00000022026
Gene Nameolfactomedin 4
SynonymsGW112, OlfD, pPD4, GC1, LOC239192, LOC380924
MMRRC Submission 042804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5232 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79984081-80023139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80021682 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 424 (N424D)
Ref Sequence ENSEMBL: ENSMUSP00000154285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088735] [ENSMUST00000228749]
Predicted Effect probably damaging
Transcript: ENSMUST00000088735
AA Change: N457D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086112
Gene: ENSMUSG00000022026
AA Change: N457D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 225 243 N/A INTRINSIC
OLF 274 532 8.53e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226541
Predicted Effect probably damaging
Transcript: ENSMUST00000228749
AA Change: N424D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally cloned from human myeloblasts and found to be selectively expressed in inflammed colonic epithelium. This gene encodes a member of the olfactomedin family. The encoded protein is an antiapoptotic factor that promotes tumor growth and is an extracellular matrix glycoprotein that facilitates cell adhesion. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced colonization of the gastric mucosa by Helicobacter pylori but increased inflammatory response to H. pylori infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,922 E1295G probably damaging Het
Adarb2 C A 13: 8,713,640 H524Q possibly damaging Het
Arhgap26 A G 18: 38,993,476 M1V probably null Het
Atp10b G A 11: 43,202,179 R447H probably damaging Het
B4galnt3 T A 6: 120,232,988 Y58F probably damaging Het
Cdca7l A G 12: 117,870,085 E79G probably damaging Het
Chd4 C G 6: 125,121,310 P350A probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Cubn A T 2: 13,478,202 C244* probably null Het
Cyfip2 A G 11: 46,242,378 S832P probably damaging Het
Dnaaf1 A C 8: 119,590,590 E286A probably benign Het
Emilin1 A G 5: 30,916,979 K188R probably benign Het
Fstl5 T C 3: 76,144,977 W5R possibly damaging Het
Gm5565 T A 5: 146,160,137 Y64F possibly damaging Het
Golga4 G A 9: 118,506,558 probably null Het
Hmcn2 T C 2: 31,457,748 L4802P probably damaging Het
Hnrnpll C T 17: 80,038,678 V385I probably damaging Het
Kctd9 A T 14: 67,724,661 D51V probably damaging Het
Lcn9 T C 2: 25,824,055 probably null Het
Map1a C A 2: 121,301,985 P856H probably damaging Het
Myo5b G C 18: 74,714,932 E1080D probably damaging Het
Naglu T C 11: 101,070,150 I9T probably benign Het
Ndst3 A T 3: 123,672,239 I28N probably damaging Het
Olfr722 A G 14: 49,895,698 Y35H probably damaging Het
Olfr742 T A 14: 50,516,038 V278E probably damaging Het
Phf13 T C 4: 151,992,223 T171A probably damaging Het
Plk3 A G 4: 117,129,120 V605A probably benign Het
Polr3a A T 14: 24,453,211 M1185K probably benign Het
Pramel7 A T 2: 87,489,976 H324Q probably damaging Het
Prpf4b T A 13: 34,883,590 probably benign Het
Pxdn C T 12: 29,990,988 T421I probably benign Het
Sertad2 C T 11: 20,648,344 T180I possibly damaging Het
Sgo2b C A 8: 63,928,602 A399S possibly damaging Het
Skint5 T C 4: 113,577,644 K1043E unknown Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Spock3 T C 8: 63,345,809 F288S probably damaging Het
Srgap1 T C 10: 121,840,911 I393V probably benign Het
Taf6 T C 5: 138,179,952 K429R possibly damaging Het
Vav1 T C 17: 57,303,846 F447L possibly damaging Het
Vmn2r19 T C 6: 123,335,957 M662T probably benign Het
Zfp541 A G 7: 16,095,179 Y1152C probably damaging Het
Other mutations in Olfm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Olfm4 APN 14 80021143 missense probably benign 0.12
IGL01108:Olfm4 APN 14 80021899 missense probably benign 0.15
IGL01599:Olfm4 APN 14 80021310 missense probably damaging 1.00
IGL01872:Olfm4 APN 14 80021928 makesense probably null
IGL01928:Olfm4 APN 14 80011952 missense possibly damaging 0.71
IGL02333:Olfm4 APN 14 80021770 missense probably damaging 1.00
IGL02336:Olfm4 APN 14 80006321 missense probably damaging 1.00
IGL02811:Olfm4 APN 14 80021673 missense probably damaging 1.00
PIT4651001:Olfm4 UTSW 14 80021485 missense probably benign 0.00
R1428:Olfm4 UTSW 14 80021403 missense probably damaging 1.00
R1649:Olfm4 UTSW 14 80011982 missense probably damaging 0.98
R2139:Olfm4 UTSW 14 80014315 missense probably benign 0.00
R2270:Olfm4 UTSW 14 80011875 missense probably damaging 0.96
R2401:Olfm4 UTSW 14 80021752 missense probably damaging 1.00
R4527:Olfm4 UTSW 14 80021224 missense probably benign 0.13
R4649:Olfm4 UTSW 14 80021307 missense probably benign 0.00
R5512:Olfm4 UTSW 14 80021347 missense probably benign 0.32
R6198:Olfm4 UTSW 14 80000373 missense probably benign 0.18
R6642:Olfm4 UTSW 14 80021667 missense probably damaging 1.00
R6828:Olfm4 UTSW 14 80021533 missense probably damaging 1.00
R6916:Olfm4 UTSW 14 80014198 missense probably damaging 0.97
R6960:Olfm4 UTSW 14 80021314 missense probably damaging 0.97
R7329:Olfm4 UTSW 14 80011929 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTGGCTGCCTACAATAATCGC -3'
(R):5'- CTGGGCGTCTGTAAGAAGAC -3'

Sequencing Primer
(F):5'- GCCTACAATAATCGCTTCTCATATG -3'
(R):5'- AGACATAAAGTTTTTGGTCAAAGGG -3'
Posted On2016-07-06