Incidental Mutation 'R5248:Pcf11'
ID398658
Institutional Source Beutler Lab
Gene Symbol Pcf11
Ensembl Gene ENSMUSG00000041328
Gene NamePCF11 cleavage and polyadenylation factor subunit
Synonyms2500001H09Rik, 5730417B17Rik
MMRRC Submission 042819-MU
Accession Numbers

Genbank: NM_029078; MGI: 1919579

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location92643543-92669934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92661491 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 221 (K221Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119954]
Predicted Effect probably damaging
Transcript: ENSMUST00000119954
AA Change: K430Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113717
Gene: ENSMUSG00000041328
AA Change: K430Q

DomainStartEndE-ValueType
RPR 17 139 6.74e-43 SMART
low complexity region 173 194 N/A INTRINSIC
coiled coil region 202 243 N/A INTRINSIC
low complexity region 355 380 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
low complexity region 471 513 N/A INTRINSIC
low complexity region 793 819 N/A INTRINSIC
low complexity region 833 853 N/A INTRINSIC
internal_repeat_1 854 931 1.77e-14 PROSPERO
low complexity region 932 948 N/A INTRINSIC
internal_repeat_1 969 1105 1.77e-14 PROSPERO
low complexity region 1159 1178 N/A INTRINSIC
low complexity region 1294 1315 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151177
AA Change: K221Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115278
Gene: ENSMUSG00000041328
AA Change: K221Q

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 147 172 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 263 305 N/A INTRINSIC
low complexity region 716 742 N/A INTRINSIC
low complexity region 756 776 N/A INTRINSIC
internal_repeat_1 777 854 3.34e-13 PROSPERO
low complexity region 855 871 N/A INTRINSIC
internal_repeat_1 892 1028 3.34e-13 PROSPERO
low complexity region 1082 1101 N/A INTRINSIC
low complexity region 1217 1238 N/A INTRINSIC
low complexity region 1368 1381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to CLP1 to form pre-mRNA cleavage factor IIm. The encoded protein is necessary for efficient Pol II transcription termination and may be involved in degradation of the 3' product of polyA site cleavage. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Pcf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Pcf11 APN 7 92661686 missense possibly damaging 0.51
IGL02439:Pcf11 APN 7 92661841 missense possibly damaging 0.93
IGL02658:Pcf11 APN 7 92647046 missense probably damaging 1.00
IGL02702:Pcf11 APN 7 92661618 missense possibly damaging 0.76
3-1:Pcf11 UTSW 7 92658518 missense probably damaging 1.00
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0078:Pcf11 UTSW 7 92669559 missense possibly damaging 0.90
R0110:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R0373:Pcf11 UTSW 7 92661215 missense probably benign
R0450:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R1717:Pcf11 UTSW 7 92663585 missense probably benign 0.00
R1952:Pcf11 UTSW 7 92661338 missense probably damaging 1.00
R1965:Pcf11 UTSW 7 92661601 missense probably benign
R2045:Pcf11 UTSW 7 92661879 missense probably damaging 1.00
R2245:Pcf11 UTSW 7 92665872 unclassified probably benign
R3824:Pcf11 UTSW 7 92659620 intron probably benign
R4439:Pcf11 UTSW 7 92658017 missense probably damaging 0.99
R4517:Pcf11 UTSW 7 92646488 missense probably damaging 1.00
R4671:Pcf11 UTSW 7 92657529 missense possibly damaging 0.62
R4674:Pcf11 UTSW 7 92659777 intron probably benign
R4675:Pcf11 UTSW 7 92659777 intron probably benign
R4732:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4733:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4758:Pcf11 UTSW 7 92661175 missense probably damaging 0.97
R4985:Pcf11 UTSW 7 92661902 missense probably benign 0.01
R5041:Pcf11 UTSW 7 92658405 missense probably benign 0.00
R5688:Pcf11 UTSW 7 92658808 missense possibly damaging 0.92
R5814:Pcf11 UTSW 7 92657714 missense probably benign 0.00
R6240:Pcf11 UTSW 7 92646502 missense probably damaging 1.00
R6327:Pcf11 UTSW 7 92659609 intron probably benign
R6615:Pcf11 UTSW 7 92657882 missense probably damaging 0.96
R6795:Pcf11 UTSW 7 92657578 missense probably benign 0.04
R6896:Pcf11 UTSW 7 92649551 missense probably damaging 0.99
R6902:Pcf11 UTSW 7 92658299 missense probably damaging 0.99
R7030:Pcf11 UTSW 7 92657678 missense probably benign 0.21
R7135:Pcf11 UTSW 7 92657316 missense probably benign 0.05
R7162:Pcf11 UTSW 7 92664013 missense probably damaging 0.97
R7210:Pcf11 UTSW 7 92663476 missense probably benign
R7243:Pcf11 UTSW 7 92660060 missense probably damaging 1.00
R7362:Pcf11 UTSW 7 92653245 missense possibly damaging 0.83
R7876:Pcf11 UTSW 7 92661326 missense probably damaging 1.00
R7959:Pcf11 UTSW 7 92661326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGACTTAGGTGACCTTGATCTTG -3'
(R):5'- CCAAGAAAGAACTTGACCAGTTAG -3'

Sequencing Primer
(F):5'- AGGTGACCTTGATCTTGATCTC -3'
(R):5'- CTAAGTCTAAATCACCATCACCTTTG -3'
Posted On2016-07-06