Incidental Mutation 'R5171:AA986860'
ID398666
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Nameexpressed sequence AA986860
Synonyms
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130731976-130744622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130742847 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 269 (Q269K)
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
Predicted Effect probably benign
Transcript: ENSMUST00000039323
AA Change: Q269K

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510
AA Change: Q269K

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130742836 missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130742722 missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130742707 missense probably benign 0.02
IGL03003:AA986860 APN 1 130743772 missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130743393 missense probably benign 0.00
R0326:AA986860 UTSW 1 130742898 missense possibly damaging 0.87
R0483:AA986860 UTSW 1 130743825 missense probably damaging 1.00
R0906:AA986860 UTSW 1 130737693 splice site probably benign
R0932:AA986860 UTSW 1 130737693 splice site probably null
R1522:AA986860 UTSW 1 130743094 missense probably damaging 1.00
R1762:AA986860 UTSW 1 130737688 critical splice donor site probably null
R1874:AA986860 UTSW 1 130742691 missense probably benign 0.06
R2083:AA986860 UTSW 1 130741069 missense probably damaging 1.00
R2091:AA986860 UTSW 1 130743169 missense probably benign 0.01
R2093:AA986860 UTSW 1 130743304 missense probably benign 0.13
R3546:AA986860 UTSW 1 130741189 splice site probably benign
R3915:AA986860 UTSW 1 130742607 missense probably benign
R4679:AA986860 UTSW 1 130742403 missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130743355 missense probably benign 0.19
R4890:AA986860 UTSW 1 130740988 splice site probably benign
R4988:AA986860 UTSW 1 130742710 missense probably damaging 1.00
R5327:AA986860 UTSW 1 130741003 missense probably damaging 1.00
R5424:AA986860 UTSW 1 130742941 missense probably damaging 1.00
R5763:AA986860 UTSW 1 130743031 missense possibly damaging 0.53
R5799:AA986860 UTSW 1 130741171 nonsense probably null
R6247:AA986860 UTSW 1 130743043 missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130742887 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGAGCACAGTTCTCATACCCC -3'
(R):5'- TTTGACAGCCAGTTCTGGGG -3'

Sequencing Primer
(F):5'- GCCAGAAGCTTTCCAGGACATTAG -3'
(R):5'- GATGGCTGTGGAAACTGCTTC -3'
Posted On2016-07-06