Incidental Mutation 'R5248:Mtmr2'
ID398667
Institutional Source Beutler Lab
Gene Symbol Mtmr2
Ensembl Gene ENSMUSG00000031918
Gene Namemyotubularin related protein 2
Synonyms6030445P13Rik
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location13748410-13806481 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 13783609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000134674] [ENSMUST00000152532] [ENSMUST00000155679] [ENSMUST00000156801]
Predicted Effect probably benign
Transcript: ENSMUST00000034396
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134530
SMART Domains Protein: ENSMUSP00000121223
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
PDB:1M7R|B 15 66 5e-15 PDB
Blast:GRAM 43 66 8e-8 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000134674
AA Change: C64R
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918
AA Change: C64R

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143002
Predicted Effect probably benign
Transcript: ENSMUST00000152532
SMART Domains Protein: ENSMUSP00000114509
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155679
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156801
AA Change: C64R
SMART Domains Protein: ENSMUSP00000117332
Gene: ENSMUSG00000031918
AA Change: C64R

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants develop progressive neuropathy characterized by myelin outfolding and recurrent loops and depletion of spermatids and spermatocytes from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Mtmr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Mtmr2 APN 9 13785916 missense probably benign 0.45
IGL01328:Mtmr2 APN 9 13801927 nonsense probably null
IGL02305:Mtmr2 APN 9 13795255 missense probably damaging 1.00
IGL03069:Mtmr2 APN 9 13793205 nonsense probably null
PIT4431001:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R0280:Mtmr2 UTSW 9 13799249 missense probably damaging 1.00
R0636:Mtmr2 UTSW 9 13801913 critical splice acceptor site probably null
R0831:Mtmr2 UTSW 9 13796113 missense probably damaging 0.99
R1202:Mtmr2 UTSW 9 13803452 missense probably benign
R1663:Mtmr2 UTSW 9 13803501 missense probably damaging 1.00
R1679:Mtmr2 UTSW 9 13789077 missense probably damaging 1.00
R2086:Mtmr2 UTSW 9 13799952 missense probably damaging 1.00
R2254:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2255:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2932:Mtmr2 UTSW 9 13749117 unclassified probably benign
R4172:Mtmr2 UTSW 9 13800062 missense probably damaging 1.00
R4669:Mtmr2 UTSW 9 13795964 missense probably damaging 1.00
R5317:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R5326:Mtmr2 UTSW 9 13788647 missense probably damaging 1.00
R5573:Mtmr2 UTSW 9 13793167 missense probably benign 0.15
R5830:Mtmr2 UTSW 9 13801978 missense probably benign 0.00
R6332:Mtmr2 UTSW 9 13800029 missense probably damaging 0.99
R6638:Mtmr2 UTSW 9 13796133 missense probably damaging 1.00
R6791:Mtmr2 UTSW 9 13805382 missense probably benign 0.02
R7072:Mtmr2 UTSW 9 13788620 missense probably benign 0.00
R7474:Mtmr2 UTSW 9 13799225 missense probably damaging 1.00
R7722:Mtmr2 UTSW 9 13804808 missense probably benign
Z1176:Mtmr2 UTSW 9 13799281 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCCATAGTCTCGTAGCT -3'
(R):5'- TCTTTCAGAACCTTGAAAATGAATGTC -3'

Sequencing Primer
(F):5'- GATACTAGTAGTCCAATGCGGCTAC -3'
(R):5'- AAGTGCTACAGTGCTTCACTCATG -3'
Posted On2016-07-06