Incidental Mutation 'R5248:Clpx'
ID 398669
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Name caseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission 042819-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5248 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 65201542-65237940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65228132 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 380 (V380A)
Ref Sequence ENSEMBL: ENSMUSP00000109455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]
AlphaFold Q9JHS4
Predicted Effect probably damaging
Transcript: ENSMUST00000015501
AA Change: V394A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: V394A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113824
AA Change: V380A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: V380A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147279
SMART Domains Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
AAA 100 192 1.89e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,437 (GRCm39) E344D probably benign Het
Acoxl G A 2: 127,917,855 (GRCm39) probably null Het
Adora1 A T 1: 134,131,224 (GRCm39) L149Q possibly damaging Het
Aebp1 C A 11: 5,818,501 (GRCm39) D115E possibly damaging Het
Ank3 A G 10: 69,822,938 (GRCm39) I1819V probably benign Het
Ankrd44 T C 1: 54,706,539 (GRCm39) H454R probably damaging Het
Ap4e1 C T 2: 126,906,842 (GRCm39) A1034V possibly damaging Het
B3galt2 T A 1: 143,522,849 (GRCm39) F328L probably benign Het
Bbip1 G A 19: 53,919,786 (GRCm39) probably benign Het
Brsk1 G A 7: 4,711,865 (GRCm39) E572K possibly damaging Het
Clca3a1 G T 3: 144,442,897 (GRCm39) P716T possibly damaging Het
Epha3 T A 16: 63,418,620 (GRCm39) Q608H probably damaging Het
Gprc6a G T 10: 51,491,089 (GRCm39) P712T probably damaging Het
Itpr1 C A 6: 108,519,023 (GRCm39) Q2720K probably damaging Het
Kdm5b A G 1: 134,548,735 (GRCm39) E1080G probably benign Het
Macf1 G A 4: 123,295,567 (GRCm39) R3163* probably null Het
Map4k5 T C 12: 69,888,755 (GRCm39) D292G probably benign Het
Mau2 A T 8: 70,481,373 (GRCm39) C217S probably benign Het
Mtf1 T C 4: 124,714,220 (GRCm39) F210L probably damaging Het
Mtif2 G A 11: 29,486,889 (GRCm39) V300M probably damaging Het
Mtmr2 T C 9: 13,694,905 (GRCm39) probably benign Het
Mybpc3 C A 2: 90,955,573 (GRCm39) probably null Het
Ncmap T C 4: 135,107,430 (GRCm39) probably null Het
Nek9 A G 12: 85,355,751 (GRCm39) F672S probably damaging Het
Nuak1 A T 10: 84,245,542 (GRCm39) I101N probably damaging Het
Or8s16 T C 15: 98,211,311 (GRCm39) N40S probably damaging Het
Pcdh7 T A 5: 58,286,515 (GRCm39) M1197K probably damaging Het
Pcdhb17 A C 18: 37,618,939 (GRCm39) Q243P probably benign Het
Pcf11 T G 7: 92,310,699 (GRCm39) K221Q probably damaging Het
Pkhd1 C T 1: 20,604,769 (GRCm39) R1182H probably benign Het
Ptprz1 C A 6: 23,001,900 (GRCm39) P1330Q probably benign Het
Rbm33 T G 5: 28,542,050 (GRCm39) probably null Het
Rhobtb1 A G 10: 69,084,615 (GRCm39) D2G probably damaging Het
Rngtt T A 4: 33,325,110 (GRCm39) C110* probably null Het
Setx T A 2: 29,038,430 (GRCm39) N1638K probably benign Het
Slc24a3 A T 2: 145,446,437 (GRCm39) M282L probably benign Het
Slc7a1 A T 5: 148,270,798 (GRCm39) V556D possibly damaging Het
Sppl2c A T 11: 104,077,407 (GRCm39) D69V possibly damaging Het
Srpk3 C T X: 72,818,555 (GRCm39) R82* probably null Het
Tas2r120 A T 6: 132,634,110 (GRCm39) N64I probably damaging Het
Tcf25 G T 8: 124,100,678 (GRCm39) A23S probably damaging Het
Tigd2 A T 6: 59,188,138 (GRCm39) K335I probably damaging Het
Tlr6 A G 5: 65,112,647 (GRCm39) S87P probably benign Het
Tmem135 T A 7: 88,797,200 (GRCm39) Y352F probably damaging Het
Tob2 T C 15: 81,735,918 (GRCm39) Y17C probably damaging Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn1r179 T C 7: 23,628,478 (GRCm39) V223A probably damaging Het
Zfp946 T C 17: 22,673,447 (GRCm39) V67A probably benign Het
Zswim4 G T 8: 84,946,561 (GRCm39) N698K probably benign Het
Zzz3 A G 3: 152,133,182 (GRCm39) Q80R probably damaging Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65,231,552 (GRCm39) missense probably damaging 1.00
IGL01394:Clpx APN 9 65,217,495 (GRCm39) missense probably damaging 1.00
IGL01395:Clpx APN 9 65,209,133 (GRCm39) missense probably benign 0.00
IGL01521:Clpx APN 9 65,226,026 (GRCm39) missense probably damaging 1.00
IGL02141:Clpx APN 9 65,219,400 (GRCm39) splice site probably null
IGL02512:Clpx APN 9 65,217,533 (GRCm39) missense probably benign
IGL03008:Clpx APN 9 65,230,057 (GRCm39) missense possibly damaging 0.76
IGL03146:Clpx APN 9 65,234,112 (GRCm39) missense probably benign 0.01
IGL03152:Clpx APN 9 65,217,458 (GRCm39) missense possibly damaging 0.56
IGL03309:Clpx APN 9 65,229,974 (GRCm39) missense probably damaging 1.00
kneehigh UTSW 9 65,209,161 (GRCm39) nonsense probably null
locust UTSW 9 65,231,583 (GRCm39) critical splice donor site probably null
IGL02837:Clpx UTSW 9 65,231,541 (GRCm39) missense probably damaging 1.00
R0167:Clpx UTSW 9 65,224,019 (GRCm39) missense possibly damaging 0.53
R0399:Clpx UTSW 9 65,230,051 (GRCm39) missense probably benign 0.03
R0666:Clpx UTSW 9 65,217,507 (GRCm39) missense probably damaging 1.00
R1386:Clpx UTSW 9 65,234,170 (GRCm39) missense probably null 0.88
R1594:Clpx UTSW 9 65,231,552 (GRCm39) missense probably damaging 0.99
R2038:Clpx UTSW 9 65,224,775 (GRCm39) missense probably damaging 1.00
R4131:Clpx UTSW 9 65,223,937 (GRCm39) missense possibly damaging 0.64
R4715:Clpx UTSW 9 65,219,396 (GRCm39) missense possibly damaging 0.92
R5107:Clpx UTSW 9 65,215,821 (GRCm39) missense possibly damaging 0.93
R5520:Clpx UTSW 9 65,224,730 (GRCm39) nonsense probably null
R5639:Clpx UTSW 9 65,237,112 (GRCm39) missense probably benign 0.00
R5718:Clpx UTSW 9 65,207,246 (GRCm39) missense probably benign
R6109:Clpx UTSW 9 65,207,234 (GRCm39) missense probably benign 0.02
R6172:Clpx UTSW 9 65,209,161 (GRCm39) nonsense probably null
R6173:Clpx UTSW 9 65,209,161 (GRCm39) nonsense probably null
R6748:Clpx UTSW 9 65,217,441 (GRCm39) missense probably benign 0.00
R7287:Clpx UTSW 9 65,207,295 (GRCm39) nonsense probably null
R7409:Clpx UTSW 9 65,231,529 (GRCm39) missense possibly damaging 0.94
R7806:Clpx UTSW 9 65,207,213 (GRCm39) missense probably benign
R7814:Clpx UTSW 9 65,231,583 (GRCm39) critical splice donor site probably null
R8212:Clpx UTSW 9 65,228,173 (GRCm39) missense possibly damaging 0.46
R8753:Clpx UTSW 9 65,223,958 (GRCm39) missense probably damaging 1.00
R8939:Clpx UTSW 9 65,231,519 (GRCm39) missense probably benign 0.00
R9023:Clpx UTSW 9 65,234,115 (GRCm39) missense probably null 0.00
X0067:Clpx UTSW 9 65,223,977 (GRCm39) missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65,207,279 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTCCTTACATGACTGTCTATTG -3'
(R):5'- CAGAAGCTAAGTGTCCATCATGTG -3'

Sequencing Primer
(F):5'- GAAATGTGGGAGTTTTCATT -3'
(R):5'- GCTAAGTGTCCATCATGTGTAATTTC -3'
Posted On 2016-07-06