Incidental Mutation 'R5248:Clpx'
ID398669
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Namecaseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65294260-65330658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65320850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 380 (V380A)
Ref Sequence ENSEMBL: ENSMUSP00000109455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]
Predicted Effect probably damaging
Transcript: ENSMUST00000015501
AA Change: V394A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: V394A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113824
AA Change: V380A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: V380A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147279
SMART Domains Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
AAA 100 192 1.89e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65324270 missense probably damaging 1.00
IGL01394:Clpx APN 9 65310213 missense probably damaging 1.00
IGL01395:Clpx APN 9 65301851 missense probably benign 0.00
IGL01521:Clpx APN 9 65318744 missense probably damaging 1.00
IGL02141:Clpx APN 9 65312118 splice site probably null
IGL02512:Clpx APN 9 65310251 missense probably benign
IGL03008:Clpx APN 9 65322775 missense possibly damaging 0.76
IGL03146:Clpx APN 9 65326830 missense probably benign 0.01
IGL03152:Clpx APN 9 65310176 missense possibly damaging 0.56
IGL03309:Clpx APN 9 65322692 missense probably damaging 1.00
kneehigh UTSW 9 65301879 nonsense probably null
locust UTSW 9 65324301 critical splice donor site probably null
IGL02837:Clpx UTSW 9 65324259 missense probably damaging 1.00
R0167:Clpx UTSW 9 65316737 missense possibly damaging 0.53
R0399:Clpx UTSW 9 65322769 missense probably benign 0.03
R0666:Clpx UTSW 9 65310225 missense probably damaging 1.00
R1386:Clpx UTSW 9 65326888 missense probably null 0.88
R1594:Clpx UTSW 9 65324270 missense probably damaging 0.99
R2038:Clpx UTSW 9 65317493 missense probably damaging 1.00
R4131:Clpx UTSW 9 65316655 missense possibly damaging 0.64
R4715:Clpx UTSW 9 65312114 missense possibly damaging 0.92
R5107:Clpx UTSW 9 65308539 missense possibly damaging 0.93
R5520:Clpx UTSW 9 65317448 nonsense probably null
R5639:Clpx UTSW 9 65329830 missense probably benign 0.00
R5718:Clpx UTSW 9 65299964 missense probably benign
R6109:Clpx UTSW 9 65299952 missense probably benign 0.02
R6172:Clpx UTSW 9 65301879 nonsense probably null
R6173:Clpx UTSW 9 65301879 nonsense probably null
R6748:Clpx UTSW 9 65310159 missense probably benign 0.00
R7287:Clpx UTSW 9 65300013 nonsense probably null
R7409:Clpx UTSW 9 65324247 missense possibly damaging 0.94
R7806:Clpx UTSW 9 65299931 missense probably benign
R7814:Clpx UTSW 9 65324301 critical splice donor site probably null
R8212:Clpx UTSW 9 65320891 missense possibly damaging 0.46
R8753:Clpx UTSW 9 65316676 missense probably damaging 1.00
X0067:Clpx UTSW 9 65316695 missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65299997 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTCCTTACATGACTGTCTATTG -3'
(R):5'- CAGAAGCTAAGTGTCCATCATGTG -3'

Sequencing Primer
(F):5'- GAAATGTGGGAGTTTTCATT -3'
(R):5'- GCTAAGTGTCCATCATGTGTAATTTC -3'
Posted On2016-07-06