Mutagenetix > Incidental Mutations

Incidental Mutation 'R5248:Clpx'

398669

Institutional Source

Beutler Lab

Gene Symbol

Clpx

Ensembl Gene

ENSMUSG00000015357

Gene Name

caseinolytic mitochondrial matrix peptidase chaperone subunit

Synonyms

MMRRC Submission

042819-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5248 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65294260-65330658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65320850 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 380 (V380A)

Ref Sequence

ENSEMBL: ENSMUSP00000109455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015501
AA Change: V394A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: V394A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
PDB:4I9K\|B	173	209	6e-7	PDB
low complexity region	259	268	N/A	INTRINSIC
AAA	286	437	1.64e-12	SMART
low complexity region	452	458	N/A	INTRINSIC
ClpB_D2-small	510	604	1.16e-29	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113824
AA Change: V380A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: V380A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
low complexity region	245	254	N/A	INTRINSIC
AAA	272	423	1.64e-12	SMART
low complexity region	438	444	N/A	INTRINSIC
ClpB_D2-small	496	590	1.16e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147279

SMART Domains

Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
AAA	100	192	1.89e-3	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,109,438	E344D	probably benign	Het
Acoxl	G	A	2: 128,075,935		probably null	Het
Adora1	A	T	1: 134,203,486	L149Q	possibly damaging	Het
Aebp1	C	A	11: 5,868,501	D115E	possibly damaging	Het
Ank3	A	G	10: 69,987,108	I1819V	probably benign	Het
Ankrd44	T	C	1: 54,667,380	H454R	probably damaging	Het
Ap4e1	C	T	2: 127,064,922	A1034V	possibly damaging	Het
B3galt2	T	A	1: 143,647,111	F328L	probably benign	Het
Bbip1	G	A	19: 53,931,355		probably benign	Het
Brsk1	G	A	7: 4,708,866	E572K	possibly damaging	Het
Clca3a1	G	T	3: 144,737,136	P716T	possibly damaging	Het
Epha3	T	A	16: 63,598,257	Q608H	probably damaging	Het
Gprc6a	G	T	10: 51,614,993	P712T	probably damaging	Het
Itpr1	C	A	6: 108,542,062	Q2720K	probably damaging	Het
Kdm5b	A	G	1: 134,620,997	E1080G	probably benign	Het
Macf1	G	A	4: 123,401,774	R3163*	probably null	Het
Map4k5	T	C	12: 69,841,981	D292G	probably benign	Het
Mau2	A	T	8: 70,028,723	C217S	probably benign	Het
Mtf1	T	C	4: 124,820,427	F210L	probably damaging	Het
Mtif2	G	A	11: 29,536,889	V300M	probably damaging	Het
Mtmr2	T	C	9: 13,783,609		probably benign	Het
Mybpc3	C	A	2: 91,125,228		probably null	Het
Ncmap	T	C	4: 135,380,119		probably null	Het
Nek9	A	G	12: 85,308,977	F672S	probably damaging	Het
Nuak1	A	T	10: 84,409,678	I101N	probably damaging	Het
Olfr285	T	C	15: 98,313,430	N40S	probably damaging	Het
Pcdh7	T	A	5: 58,129,173	M1197K	probably damaging	Het
Pcdhb17	A	C	18: 37,485,886	Q243P	probably benign	Het
Pcf11	T	G	7: 92,661,491	K221Q	probably damaging	Het
Pkhd1	C	T	1: 20,534,545	R1182H	probably benign	Het
Ptprz1	C	A	6: 23,001,901	P1330Q	probably benign	Het
Rbm33	T	G	5: 28,337,052		probably null	Het
Rhobtb1	A	G	10: 69,248,785	D2G	probably damaging	Het
Rngtt	T	A	4: 33,325,110	C110*	probably null	Het
Setx	T	A	2: 29,148,418	N1638K	probably benign	Het
Slc24a3	A	T	2: 145,604,517	M282L	probably benign	Het
Slc7a1	A	T	5: 148,333,988	V556D	possibly damaging	Het
Sppl2c	A	T	11: 104,186,581	D69V	possibly damaging	Het
Srpk3	C	T	X: 73,774,949	R82*	probably null	Het
Tas2r120	A	T	6: 132,657,147	N64I	probably damaging	Het
Tcf25	G	T	8: 123,373,939	A23S	probably damaging	Het
Tigd2	A	T	6: 59,211,153	K335I	probably damaging	Het
Tlr6	A	G	5: 64,955,304	S87P	probably benign	Het
Tmem135	T	A	7: 89,147,992	Y352F	probably damaging	Het
Tob2	T	C	15: 81,851,717	Y17C	probably damaging	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Vmn1r179	T	C	7: 23,929,053	V223A	probably damaging	Het
Zfp946	T	C	17: 22,454,466	V67A	probably benign	Het
Zswim4	G	T	8: 84,219,932	N698K	probably benign	Het
Zzz3	A	G	3: 152,427,545	Q80R	probably damaging	Het

Other mutations in Clpx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Clpx	APN	9	65324270	missense	probably damaging	1.00
IGL01394:Clpx	APN	9	65310213	missense	probably damaging	1.00
IGL01395:Clpx	APN	9	65301851	missense	probably benign	0.00
IGL01521:Clpx	APN	9	65318744	missense	probably damaging	1.00
IGL02141:Clpx	APN	9	65312118	splice site	probably null
IGL02512:Clpx	APN	9	65310251	missense	probably benign
IGL03008:Clpx	APN	9	65322775	missense	possibly damaging	0.76
IGL03146:Clpx	APN	9	65326830	missense	probably benign	0.01
IGL03152:Clpx	APN	9	65310176	missense	possibly damaging	0.56
IGL03309:Clpx	APN	9	65322692	missense	probably damaging	1.00
kneehigh	UTSW	9	65301879	nonsense	probably null
locust	UTSW	9	65324301	critical splice donor site	probably null
IGL02837:Clpx	UTSW	9	65324259	missense	probably damaging	1.00
R0167:Clpx	UTSW	9	65316737	missense	possibly damaging	0.53
R0399:Clpx	UTSW	9	65322769	missense	probably benign	0.03
R0666:Clpx	UTSW	9	65310225	missense	probably damaging	1.00
R1386:Clpx	UTSW	9	65326888	missense	probably null	0.88
R1594:Clpx	UTSW	9	65324270	missense	probably damaging	0.99
R2038:Clpx	UTSW	9	65317493	missense	probably damaging	1.00
R4131:Clpx	UTSW	9	65316655	missense	possibly damaging	0.64
R4715:Clpx	UTSW	9	65312114	missense	possibly damaging	0.92
R5107:Clpx	UTSW	9	65308539	missense	possibly damaging	0.93
R5520:Clpx	UTSW	9	65317448	nonsense	probably null
R5639:Clpx	UTSW	9	65329830	missense	probably benign	0.00
R5718:Clpx	UTSW	9	65299964	missense	probably benign
R6109:Clpx	UTSW	9	65299952	missense	probably benign	0.02
R6172:Clpx	UTSW	9	65301879	nonsense	probably null
R6173:Clpx	UTSW	9	65301879	nonsense	probably null
R6748:Clpx	UTSW	9	65310159	missense	probably benign	0.00
R7287:Clpx	UTSW	9	65300013	nonsense	probably null
R7409:Clpx	UTSW	9	65324247	missense	possibly damaging	0.94
R7806:Clpx	UTSW	9	65299931	missense	probably benign
R7814:Clpx	UTSW	9	65324301	critical splice donor site	probably null
R8212:Clpx	UTSW	9	65320891	missense	possibly damaging	0.46
R8753:Clpx	UTSW	9	65316676	missense	probably damaging	1.00
X0067:Clpx	UTSW	9	65316695	missense	possibly damaging	0.86
Z1177:Clpx	UTSW	9	65299997	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCTCCTTACATGACTGTCTATTG -3'
(R):5'- CAGAAGCTAAGTGTCCATCATGTG -3'

Sequencing Primer
(F):5'- GAAATGTGGGAGTTTTCATT -3'
(R):5'- GCTAAGTGTCCATCATGTGTAATTTC -3'

Posted On

2016-07-06