Incidental Mutation 'R5171:Ifi214'
ID 398671
Institutional Source Beutler Lab
Gene Symbol Ifi214
Ensembl Gene ENSMUSG00000070501
Gene Name interferon activated gene 214
Synonyms BC094916, Pyhin-B
MMRRC Submission 042751-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5171 (G1)
Quality Score 175
Status Validated
Chromosome 1
Chromosomal Location 173348877-173363523 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 173354200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 157 (S157P)
Ref Sequence ENSEMBL: ENSMUSP00000087888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090406] [ENSMUST00000097463] [ENSMUST00000139092]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090406
AA Change: S157P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087888
Gene: ENSMUSG00000070501
AA Change: S157P

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 393 9.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097463
AA Change: S157P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095071
Gene: ENSMUSG00000070501
AA Change: S157P

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139092
AA Change: S157P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115105
Gene: ENSMUSG00000070501
AA Change: S157P

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197288
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the PAAD/DAPIN/Pyrin domain family of proteins. However, compared to the related pyrin and HIN domain family, member 1 (Pyhin1) protein, this protein is C-terminally truncated and lacks a HIN domain, which has an unknown function. It is therefore possible that this gene represents a pseudogene of the Pyhin1 gene, but it is currently being retained as a functional protein-coding gene based on the presence of an intact PAAD/DAPIN/Pyrin domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,670,584 (GRCm39) Q269K probably benign Het
Acad9 T A 3: 36,128,547 (GRCm39) I136N possibly damaging Het
Adtrp A G 13: 41,931,039 (GRCm39) S183P probably damaging Het
Atp11b C T 3: 35,887,086 (GRCm39) T690I probably damaging Het
Bcl2l12 G A 7: 44,640,818 (GRCm39) probably benign Het
Btnl7-ps T A 17: 34,752,503 (GRCm39) noncoding transcript Het
Ccl12 T C 11: 81,993,460 (GRCm39) C33R probably damaging Het
Cdc25a T A 9: 109,706,229 (GRCm39) S57R probably benign Het
Coro2a T A 4: 46,542,372 (GRCm39) probably benign Het
Cpne6 T C 14: 55,749,605 (GRCm39) V55A possibly damaging Het
Ddn A G 15: 98,704,207 (GRCm39) S362P possibly damaging Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Donson A G 16: 91,478,181 (GRCm39) V258A possibly damaging Het
Gm3336 G A 8: 71,174,524 (GRCm39) V163I probably benign Het
Gper1 C T 5: 139,412,413 (GRCm39) R253C probably damaging Het
Gpsm1 T A 2: 26,217,476 (GRCm39) probably benign Het
Hip1 A G 5: 135,469,156 (GRCm39) S251P probably damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Kntc1 T C 5: 123,937,907 (GRCm39) V1535A probably benign Het
Mbd3l1 A G 9: 18,396,430 (GRCm39) N185S probably benign Het
Mnx1 T C 5: 29,679,851 (GRCm39) Q252R unknown Het
Mroh3 A T 1: 136,119,394 (GRCm39) L463Q possibly damaging Het
Myom1 T C 17: 71,406,967 (GRCm39) V1030A possibly damaging Het
Or3a1d T C 11: 74,237,640 (GRCm39) T257A probably benign Het
Or5ak20 T C 2: 85,184,114 (GRCm39) D52G probably benign Het
Or5w1 T G 2: 87,486,888 (GRCm39) I126L possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Ranbp17 A G 11: 33,167,419 (GRCm39) Y1015H probably benign Het
Rasal1 C T 5: 120,801,829 (GRCm39) T256I probably benign Het
Rexo5 T A 7: 119,423,002 (GRCm39) I278N probably damaging Het
Rims2 T A 15: 39,300,499 (GRCm39) S77T probably damaging Het
Sdk2 C T 11: 113,741,808 (GRCm39) A804T probably benign Het
Slc24a2 T A 4: 86,914,871 (GRCm39) I589F probably benign Het
Slc25a38 T A 9: 119,951,181 (GRCm39) I217K probably benign Het
Slc5a7 T C 17: 54,583,704 (GRCm39) T529A probably benign Het
Spata22 T A 11: 73,227,034 (GRCm39) S83T probably damaging Het
Spata31e4 A T 13: 50,854,414 (GRCm39) T91S possibly damaging Het
Stac2 A T 11: 97,934,324 (GRCm39) C127S possibly damaging Het
Tep1 T C 14: 51,062,259 (GRCm39) H2531R probably benign Het
Tmem151a G T 19: 5,132,061 (GRCm39) R382S probably damaging Het
Trim60 T C 8: 65,453,176 (GRCm39) T358A probably benign Het
Unc13c T A 9: 73,665,236 (GRCm39) M1048L probably benign Het
Usp29 T C 7: 6,965,074 (GRCm39) S306P probably damaging Het
Zfp26 T C 9: 20,356,203 (GRCm39) K35R probably benign Het
Zfp462 T A 4: 55,016,986 (GRCm39) probably null Het
Other mutations in Ifi214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ifi214 APN 1 173,356,995 (GRCm39) missense probably damaging 0.99
IGL01418:Ifi214 APN 1 173,356,995 (GRCm39) missense probably damaging 0.99
IGL01821:Ifi214 APN 1 173,356,891 (GRCm39) missense probably damaging 0.97
IGL03341:Ifi214 APN 1 173,354,082 (GRCm39) missense possibly damaging 0.86
PIT4305001:Ifi214 UTSW 1 173,355,485 (GRCm39) missense probably benign 0.00
R1908:Ifi214 UTSW 1 173,357,077 (GRCm39) missense probably benign 0.44
R4239:Ifi214 UTSW 1 173,352,509 (GRCm39) missense possibly damaging 0.92
R4731:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R4732:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R4733:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R5531:Ifi214 UTSW 1 173,352,686 (GRCm39) missense probably damaging 1.00
R6290:Ifi214 UTSW 1 173,356,983 (GRCm39) missense probably damaging 1.00
R6499:Ifi214 UTSW 1 173,352,597 (GRCm39) missense probably damaging 0.99
R7271:Ifi214 UTSW 1 173,357,042 (GRCm39) missense probably damaging 0.96
R7290:Ifi214 UTSW 1 173,357,097 (GRCm39) missense probably benign 0.03
R7765:Ifi214 UTSW 1 173,352,402 (GRCm39) missense probably damaging 0.96
R8712:Ifi214 UTSW 1 173,355,486 (GRCm39) missense possibly damaging 0.83
R8807:Ifi214 UTSW 1 173,354,133 (GRCm39) missense possibly damaging 0.86
R9144:Ifi214 UTSW 1 173,355,434 (GRCm39) missense possibly damaging 0.92
R9452:Ifi214 UTSW 1 173,356,894 (GRCm39) missense possibly damaging 0.79
R9534:Ifi214 UTSW 1 173,354,092 (GRCm39) missense probably benign 0.18
R9721:Ifi214 UTSW 1 173,355,479 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTCCAAGGTTGCAATAGCCATC -3'
(R):5'- AGAGCCATCTTATATGTTTGCCAG -3'

Sequencing Primer
(F):5'- CAGAAAATTACCTTGGCTGGTG -3'
(R):5'- ATGTTTGCCAGAATCTGACTCATC -3'
Posted On 2016-07-06