Incidental Mutation 'R5248:Rhobtb1'
ID398672
Institutional Source Beutler Lab
Gene Symbol Rhobtb1
Ensembl Gene ENSMUSG00000019944
Gene NameRho-related BTB domain containing 1
Synonyms
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location69151434-69291791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69248785 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000131313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020101] [ENSMUST00000067908] [ENSMUST00000163497] [ENSMUST00000164034] [ENSMUST00000164212] [ENSMUST00000167286] [ENSMUST00000167384] [ENSMUST00000168117] [ENSMUST00000172261]
Predicted Effect probably benign
Transcript: ENSMUST00000020101
AA Change: D2G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020101
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067908
AA Change: D2G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000065095
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163497
AA Change: D2G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129119
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Ras 16 96 1.8e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164034
AA Change: D2G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132068
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164212
AA Change: D2G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128356
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Ras 16 94 1.8e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164876
Predicted Effect probably damaging
Transcript: ENSMUST00000167286
AA Change: D2G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131313
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Ras 16 93 1.7e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167384
AA Change: D2G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131222
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
PDB:3RYT|C 10 97 8e-6 PDB
SCOP:d1ky3a_ 15 150 8e-16 SMART
Blast:RHO 17 99 5e-50 BLAST
low complexity region 163 184 N/A INTRINSIC
BTB 204 394 6.29e-13 SMART
BTB 422 520 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168117
AA Change: D2G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131509
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Ras 16 97 1.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172261
AA Change: D2G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128667
Gene: ENSMUSG00000019944
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Ras 16 95 1.8e-5 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Rho family of the small GTPase superfamily. It contains a GTPase domain, a proline-rich region, a tandem of 2 BTB (broad complex, tramtrack, and bric-a-brac) domains, and a conserved C-terminal region. The protein plays a role in small GTPase-mediated signal transduction and the organization of the actin filament system. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Rhobtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Rhobtb1 APN 10 69270221 missense probably damaging 1.00
IGL01504:Rhobtb1 APN 10 69249698 missense probably damaging 1.00
IGL01561:Rhobtb1 APN 10 69270391 missense probably benign 0.17
IGL01924:Rhobtb1 APN 10 69270304 missense probably damaging 1.00
IGL02252:Rhobtb1 APN 10 69249685 missense probably damaging 1.00
IGL02334:Rhobtb1 APN 10 69285678 splice site probably benign
IGL02393:Rhobtb1 APN 10 69288987 missense probably damaging 1.00
IGL02514:Rhobtb1 APN 10 69289641 missense probably benign 0.00
IGL03192:Rhobtb1 APN 10 69248823 missense probably damaging 1.00
R1687:Rhobtb1 UTSW 10 69270279 missense probably damaging 1.00
R1713:Rhobtb1 UTSW 10 69272771 missense probably benign 0.05
R1713:Rhobtb1 UTSW 10 69272772 missense possibly damaging 0.61
R1750:Rhobtb1 UTSW 10 69279406 missense probably damaging 1.00
R2044:Rhobtb1 UTSW 10 69272863 splice site probably benign
R2312:Rhobtb1 UTSW 10 69270463 nonsense probably null
R2402:Rhobtb1 UTSW 10 69270424 missense probably benign 0.00
R3815:Rhobtb1 UTSW 10 69285693 missense possibly damaging 0.75
R4633:Rhobtb1 UTSW 10 69249613 splice site probably null
R4737:Rhobtb1 UTSW 10 69279497 critical splice donor site probably null
R4780:Rhobtb1 UTSW 10 69270153 missense probably benign 0.02
R4865:Rhobtb1 UTSW 10 69270724 missense probably benign 0.04
R5124:Rhobtb1 UTSW 10 69269901 critical splice acceptor site probably null
R5304:Rhobtb1 UTSW 10 69269912 missense probably damaging 1.00
R5480:Rhobtb1 UTSW 10 69270733 missense possibly damaging 0.86
R5836:Rhobtb1 UTSW 10 69269989 missense probably damaging 1.00
R5951:Rhobtb1 UTSW 10 69270255 missense probably damaging 0.99
R6218:Rhobtb1 UTSW 10 69270456 missense probably benign 0.00
R6629:Rhobtb1 UTSW 10 69270316 missense possibly damaging 0.92
R6869:Rhobtb1 UTSW 10 69270226 missense probably damaging 0.99
R7081:Rhobtb1 UTSW 10 69266297 missense probably benign 0.29
R7260:Rhobtb1 UTSW 10 69270780 nonsense probably null
R7427:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R7428:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCGCAGGAATAAACTGTTCAG -3'
(R):5'- CACGGTACTGATCAATGGCC -3'

Sequencing Primer
(F):5'- CTGTTCAGGGTCAAAATAACAGTGTG -3'
(R):5'- TGATCAATGGCCCACACGG -3'
Posted On2016-07-06