Incidental Mutation 'R5171:Rasal1'
List |< first << previous [record 32 of 47] next >> last >|
ID398699
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120663764 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 256 (T256I)
Ref Sequence ENSEMBL: ENSMUSP00000123266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000156722]
Predicted Effect probably benign
Transcript: ENSMUST00000031606
AA Change: T256I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: T256I

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148695
Predicted Effect probably benign
Transcript: ENSMUST00000156722
AA Change: T256I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: T256I

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
R7042:Rasal1 UTSW 5 120663960 splice site probably null
R7194:Rasal1 UTSW 5 120675492 missense probably benign
R7356:Rasal1 UTSW 5 120654825 missense possibly damaging 0.65
R7406:Rasal1 UTSW 5 120662937 missense probably benign 0.11
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGATGCCTCCACACACTG -3'
(R):5'- ATAATCTAGAAAGGGCCCGGC -3'

Sequencing Primer
(F):5'- GTCCATTTCGGTCCCCACTG -3'
(R):5'- AAGGTCCTGACGACAGTCC -3'
Posted On2016-07-06