Incidental Mutation 'R5171:Usp29'
List |< first << previous [record 45 of 47] next >> last >|
ID398709
Institutional Source Beutler Lab
Gene Symbol Usp29
Ensembl Gene ENSMUSG00000051527
Gene Nameubiquitin specific peptidase 29
SynonymsOcat
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6730578-6967219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6962075 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 306 (S306P)
Ref Sequence ENSEMBL: ENSMUSP00000143769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054055] [ENSMUST00000197117] [ENSMUST00000198068] [ENSMUST00000200535]
Predicted Effect probably damaging
Transcript: ENSMUST00000054055
AA Change: S306P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062349
Gene: ENSMUSG00000051527
AA Change: S306P

DomainStartEndE-ValueType
Pfam:UCH_N 1 107 6.1e-37 PFAM
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:UCH 288 823 6.1e-53 PFAM
Pfam:UCH_1 289 615 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197117
SMART Domains Protein: ENSMUSP00000143283
Gene: ENSMUSG00000051527

DomainStartEndE-ValueType
PDB:3U12|B 11 73 3e-7 PDB
low complexity region 82 95 N/A INTRINSIC
low complexity region 169 186 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198068
AA Change: S306P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143267
Gene: ENSMUSG00000051527
AA Change: S306P

DomainStartEndE-ValueType
PDB:3U12|B 11 123 3e-6 PDB
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 7.9e-52 PFAM
Pfam:UCH_1 296 626 9.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200535
AA Change: S306P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143769
Gene: ENSMUSG00000051527
AA Change: S306P

DomainStartEndE-ValueType
Pfam:UCH_N 8 114 8.3e-34 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 2.8e-51 PFAM
Pfam:UCH_1 296 622 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204486
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Usp29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Usp29 APN 7 6962282 missense probably benign 0.06
IGL01588:Usp29 APN 7 6962611 missense probably benign 0.33
IGL02032:Usp29 APN 7 6962018 missense probably benign 0.41
IGL02052:Usp29 APN 7 6962526 missense probably benign 0.06
IGL02331:Usp29 APN 7 6962156 missense probably benign 0.16
IGL02551:Usp29 APN 7 6963353 unclassified probably null
IGL02573:Usp29 APN 7 6962618 unclassified probably null
IGL02894:Usp29 APN 7 6961634 missense probably benign 0.00
R0029:Usp29 UTSW 7 6961581 missense probably damaging 0.99
R0142:Usp29 UTSW 7 6962335 missense probably benign 0.12
R0452:Usp29 UTSW 7 6963182 missense possibly damaging 0.82
R0680:Usp29 UTSW 7 6962885 missense possibly damaging 0.92
R1161:Usp29 UTSW 7 6961530 missense probably damaging 1.00
R2391:Usp29 UTSW 7 6963771 unclassified probably null
R3104:Usp29 UTSW 7 6962053 nonsense probably null
R4119:Usp29 UTSW 7 6962806 missense probably benign 0.03
R4490:Usp29 UTSW 7 6961950 missense possibly damaging 0.68
R4598:Usp29 UTSW 7 6962480 missense probably benign 0.06
R4606:Usp29 UTSW 7 6963357 unclassified probably null
R4670:Usp29 UTSW 7 6962915 missense possibly damaging 0.91
R4777:Usp29 UTSW 7 6962748 missense probably benign 0.07
R4783:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4785:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4896:Usp29 UTSW 7 6962159 missense probably benign 0.29
R4915:Usp29 UTSW 7 6961505 missense probably benign
R4944:Usp29 UTSW 7 6961928 missense possibly damaging 0.92
R5004:Usp29 UTSW 7 6962159 missense probably benign 0.29
R5268:Usp29 UTSW 7 6961584 missense probably damaging 0.98
R5572:Usp29 UTSW 7 6962192 missense probably benign 0.12
R5933:Usp29 UTSW 7 6961745 missense probably benign
R6694:Usp29 UTSW 7 6962277 missense probably benign 0.03
R7389:Usp29 UTSW 7 6963458 missense possibly damaging 0.82
R7446:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7447:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7535:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7537:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAAATCCTATGGAAGGGCTAAC -3'
(R):5'- CCCGAGAATGTGTCTGCAAC -3'

Sequencing Primer
(F):5'- GCTAACCTGGATGGCACTATC -3'
(R):5'- CTGCAACTGTGGAAATGGACTTC -3'
Posted On2016-07-06