Incidental Mutation 'R5171:Dmpk'
ID 398711
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Name dystrophia myotonica-protein kinase
Synonyms Dm15, DM
MMRRC Submission 042751-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.421) question?
Stock # R5171 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 18817774-18827746 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 18821944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 301 (L301V)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000122999] [ENSMUST00000154199]
AlphaFold P54265
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect probably benign
Transcript: ENSMUST00000154199
AA Change: L301V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,670,584 (GRCm39) Q269K probably benign Het
Acad9 T A 3: 36,128,547 (GRCm39) I136N possibly damaging Het
Adtrp A G 13: 41,931,039 (GRCm39) S183P probably damaging Het
Atp11b C T 3: 35,887,086 (GRCm39) T690I probably damaging Het
Bcl2l12 G A 7: 44,640,818 (GRCm39) probably benign Het
Btnl7-ps T A 17: 34,752,503 (GRCm39) noncoding transcript Het
Ccl12 T C 11: 81,993,460 (GRCm39) C33R probably damaging Het
Cdc25a T A 9: 109,706,229 (GRCm39) S57R probably benign Het
Coro2a T A 4: 46,542,372 (GRCm39) probably benign Het
Cpne6 T C 14: 55,749,605 (GRCm39) V55A possibly damaging Het
Ddn A G 15: 98,704,207 (GRCm39) S362P possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Donson A G 16: 91,478,181 (GRCm39) V258A possibly damaging Het
Gm3336 G A 8: 71,174,524 (GRCm39) V163I probably benign Het
Gper1 C T 5: 139,412,413 (GRCm39) R253C probably damaging Het
Gpsm1 T A 2: 26,217,476 (GRCm39) probably benign Het
Hip1 A G 5: 135,469,156 (GRCm39) S251P probably damaging Het
Ifi214 A G 1: 173,354,200 (GRCm39) S157P possibly damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Kntc1 T C 5: 123,937,907 (GRCm39) V1535A probably benign Het
Mbd3l1 A G 9: 18,396,430 (GRCm39) N185S probably benign Het
Mnx1 T C 5: 29,679,851 (GRCm39) Q252R unknown Het
Mroh3 A T 1: 136,119,394 (GRCm39) L463Q possibly damaging Het
Myom1 T C 17: 71,406,967 (GRCm39) V1030A possibly damaging Het
Or3a1d T C 11: 74,237,640 (GRCm39) T257A probably benign Het
Or5ak20 T C 2: 85,184,114 (GRCm39) D52G probably benign Het
Or5w1 T G 2: 87,486,888 (GRCm39) I126L possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Ranbp17 A G 11: 33,167,419 (GRCm39) Y1015H probably benign Het
Rasal1 C T 5: 120,801,829 (GRCm39) T256I probably benign Het
Rexo5 T A 7: 119,423,002 (GRCm39) I278N probably damaging Het
Rims2 T A 15: 39,300,499 (GRCm39) S77T probably damaging Het
Sdk2 C T 11: 113,741,808 (GRCm39) A804T probably benign Het
Slc24a2 T A 4: 86,914,871 (GRCm39) I589F probably benign Het
Slc25a38 T A 9: 119,951,181 (GRCm39) I217K probably benign Het
Slc5a7 T C 17: 54,583,704 (GRCm39) T529A probably benign Het
Spata22 T A 11: 73,227,034 (GRCm39) S83T probably damaging Het
Spata31e4 A T 13: 50,854,414 (GRCm39) T91S possibly damaging Het
Stac2 A T 11: 97,934,324 (GRCm39) C127S possibly damaging Het
Tep1 T C 14: 51,062,259 (GRCm39) H2531R probably benign Het
Tmem151a G T 19: 5,132,061 (GRCm39) R382S probably damaging Het
Trim60 T C 8: 65,453,176 (GRCm39) T358A probably benign Het
Unc13c T A 9: 73,665,236 (GRCm39) M1048L probably benign Het
Usp29 T C 7: 6,965,074 (GRCm39) S306P probably damaging Het
Zfp26 T C 9: 20,356,203 (GRCm39) K35R probably benign Het
Zfp462 T A 4: 55,016,986 (GRCm39) probably null Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 18,822,117 (GRCm39) missense probably damaging 0.98
IGL02874:Dmpk APN 7 18,820,926 (GRCm39) missense possibly damaging 0.75
IGL02942:Dmpk APN 7 18,826,166 (GRCm39) missense probably damaging 0.99
IGL03081:Dmpk APN 7 18,821,458 (GRCm39) missense probably damaging 1.00
IGL03258:Dmpk APN 7 18,826,131 (GRCm39) critical splice acceptor site probably null
IGL03302:Dmpk APN 7 18,820,411 (GRCm39) splice site probably benign
P0008:Dmpk UTSW 7 18,821,987 (GRCm39) missense possibly damaging 0.89
R0388:Dmpk UTSW 7 18,818,002 (GRCm39) unclassified probably benign
R0961:Dmpk UTSW 7 18,821,195 (GRCm39) missense probably damaging 0.99
R3103:Dmpk UTSW 7 18,821,579 (GRCm39) missense probably damaging 1.00
R3157:Dmpk UTSW 7 18,826,944 (GRCm39) missense probably benign 0.00
R3158:Dmpk UTSW 7 18,826,944 (GRCm39) missense probably benign 0.00
R3159:Dmpk UTSW 7 18,826,944 (GRCm39) missense probably benign 0.00
R3498:Dmpk UTSW 7 18,820,306 (GRCm39) missense probably damaging 1.00
R4696:Dmpk UTSW 7 18,822,139 (GRCm39) missense probably damaging 1.00
R4830:Dmpk UTSW 7 18,821,453 (GRCm39) missense probably damaging 1.00
R4991:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5156:Dmpk UTSW 7 18,818,050 (GRCm39) missense probably damaging 1.00
R5169:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5170:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5172:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5198:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5200:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5202:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5205:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5383:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5449:Dmpk UTSW 7 18,824,916 (GRCm39) missense probably benign 0.18
R5639:Dmpk UTSW 7 18,826,525 (GRCm39) missense probably benign 0.22
R5874:Dmpk UTSW 7 18,826,007 (GRCm39) intron probably benign
R6939:Dmpk UTSW 7 18,822,149 (GRCm39) missense probably damaging 0.97
R7133:Dmpk UTSW 7 18,821,232 (GRCm39) missense probably damaging 1.00
R7352:Dmpk UTSW 7 18,819,997 (GRCm39) missense probably damaging 0.98
R8032:Dmpk UTSW 7 18,821,978 (GRCm39) missense possibly damaging 0.63
R8234:Dmpk UTSW 7 18,822,048 (GRCm39) missense probably benign 0.00
R8886:Dmpk UTSW 7 18,825,886 (GRCm39) unclassified probably benign
R9052:Dmpk UTSW 7 18,821,614 (GRCm39) missense probably damaging 0.99
R9235:Dmpk UTSW 7 18,822,141 (GRCm39) missense probably damaging 1.00
R9420:Dmpk UTSW 7 18,824,946 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAGTGGCTTGTGCTCCCAG -3'
(R):5'- CCCTCGAAGTCTGGTGTAAAGG -3'

Sequencing Primer
(F):5'- CACTGAGTAGGTGTGCGAAGGTC -3'
(R):5'- GGGGGTACACTGTCTCGGAG -3'
Posted On 2016-07-06