Incidental Mutation 'R5248:Srpk3'
ID398714
Institutional Source Beutler Lab
Gene Symbol Srpk3
Ensembl Gene ENSMUSG00000002007
Gene Nameserine/arginine-rich protein specific kinase 3
SynonymsStk23, Mssk1
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5248 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location73774405-73778925 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 73774949 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 82 (R82*)
Ref Sequence ENSEMBL: ENSMUSP00000002081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002079] [ENSMUST00000002081] [ENSMUST00000052761]
Predicted Effect probably benign
Transcript: ENSMUST00000002079
SMART Domains Protein: ENSMUSP00000002079
Gene: ENSMUSG00000031385

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Sema 44 445 5.53e-102 SMART
PSI 463 515 8.91e-10 SMART
Blast:Sema 533 592 2e-9 BLAST
PSI 609 671 8.95e-1 SMART
PSI 776 822 5e-1 SMART
IPT 823 914 7.15e-15 SMART
IPT 915 1001 5.63e-13 SMART
IPT 1003 1134 7.17e-1 SMART
Pfam:TIG 1148 1232 7.7e-7 PFAM
low complexity region 1246 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1317 1869 2.7e-225 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000002081
AA Change: R82*
SMART Domains Protein: ENSMUSP00000002081
Gene: ENSMUSG00000002007
AA Change: R82*

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
Pfam:Pkinase 78 228 1.4e-22 PFAM
Pfam:Pkinase_Tyr 78 230 1.1e-9 PFAM
coiled coil region 260 300 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 341 360 N/A INTRINSIC
Pfam:Pkinase 385 563 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052761
SMART Domains Protein: ENSMUSP00000056502
Gene: ENSMUSG00000002010

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Iso_dh 56 379 1.1e-141 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156299
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase similar to a protein kinase which is specific for the SR (serine/arginine-rich domain) family of splicing factors. A highly similar protein has been shown to play a role in muscle development in mice. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mice exhibit defects in skeletal muscle growth and myopathy of type 2 muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Srpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Srpk3 APN X 73775148 missense probably benign 0.33
Myo_bone UTSW X 73774949 nonsense probably null
R1822:Srpk3 UTSW X 73777955 missense possibly damaging 0.79
R1823:Srpk3 UTSW X 73777955 missense possibly damaging 0.79
R4601:Srpk3 UTSW X 73774941 missense possibly damaging 0.47
R4611:Srpk3 UTSW X 73774941 missense possibly damaging 0.47
R5246:Srpk3 UTSW X 73774949 nonsense probably null
R5247:Srpk3 UTSW X 73774949 nonsense probably null
R5249:Srpk3 UTSW X 73774949 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGCAAGGGTAAGGCCTGG -3'
(R):5'- CACTTTCAGGGCCACAAAGC -3'

Sequencing Primer
(F):5'- CAAGGGCTCAGGACAGCTTG -3'
(R):5'- AAAGCGCTTGCGCCTGTAATATG -3'
Posted On2016-07-06