Incidental Mutation 'R5171:Trim60'
ID398718
Institutional Source Beutler Lab
Gene Symbol Trim60
Ensembl Gene ENSMUSG00000053490
Gene Nametripartite motif-containing 60
SynonymsRnf33, 2czf45
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location64999307-65018584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65000524 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 358 (T358A)
Ref Sequence ENSEMBL: ENSMUSP00000040299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048565]
Predicted Effect probably benign
Transcript: ENSMUST00000048565
AA Change: T358A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040299
Gene: ENSMUSG00000053490
AA Change: T358A

DomainStartEndE-ValueType
RING 15 55 1.48e-7 SMART
low complexity region 81 90 N/A INTRINSIC
BBOX 91 132 3.12e-6 SMART
PRY 289 341 4.11e-15 SMART
Pfam:SPRY 344 459 2e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. Pseudogenes of this gene are located on more than six chromosomes including chromosome 4. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Trim60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim60 APN 8 65000719 missense possibly damaging 0.61
IGL03145:Trim60 APN 8 65000572 missense probably damaging 0.99
R0054:Trim60 UTSW 8 65001321 missense probably benign 0.05
R0054:Trim60 UTSW 8 65001321 missense probably benign 0.05
R0080:Trim60 UTSW 8 65000599 missense probably damaging 1.00
R0244:Trim60 UTSW 8 65001048 missense probably benign 0.07
R0348:Trim60 UTSW 8 65001216 missense probably damaging 1.00
R1104:Trim60 UTSW 8 65001419 missense probably benign 0.04
R1615:Trim60 UTSW 8 65000510 nonsense probably null
R1667:Trim60 UTSW 8 65001464 missense probably benign 0.00
R1944:Trim60 UTSW 8 65001312 missense possibly damaging 0.95
R2009:Trim60 UTSW 8 65001323 missense probably damaging 0.99
R4093:Trim60 UTSW 8 65001378 missense probably benign 0.05
R4400:Trim60 UTSW 8 65001212 nonsense probably null
R5898:Trim60 UTSW 8 65000364 nonsense probably null
R6586:Trim60 UTSW 8 65000596 missense possibly damaging 0.61
R7012:Trim60 UTSW 8 65000391 missense possibly damaging 0.93
R7092:Trim60 UTSW 8 65001048 missense probably benign 0.07
R7274:Trim60 UTSW 8 65000481 missense possibly damaging 0.76
R7567:Trim60 UTSW 8 65001525 missense probably damaging 0.97
R7761:Trim60 UTSW 8 65001312 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGTAGAGAAGAGACCTGTCATTC -3'
(R):5'- TGATCGTGACACAGCACACC -3'

Sequencing Primer
(F):5'- TTATAAAAGGAGAGCTCACCCAATTC -3'
(R):5'- ACCCTCAGCTGGTTATTTCTGAGG -3'
Posted On2016-07-06