Incidental Mutation 'R5171:Ddn'
ID398750
Institutional Source Beutler Lab
Gene Symbol Ddn
Ensembl Gene ENSMUSG00000059213
Gene Namedendrin
SynonymsLOC328602
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98803777-98809490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98806326 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 362 (S362P)
Ref Sequence ENSEMBL: ENSMUSP00000074895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075444] [ENSMUST00000230409]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075444
AA Change: S362P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074895
Gene: ENSMUSG00000059213
AA Change: S362P

DomainStartEndE-ValueType
Pfam:Dendrin 55 708 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229573
Predicted Effect probably benign
Transcript: ENSMUST00000230409
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal proteinuria in resposne to LPS treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Ddn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1444:Ddn UTSW 15 98806604 missense probably damaging 0.98
R1499:Ddn UTSW 15 98806766 missense possibly damaging 0.89
R4419:Ddn UTSW 15 98805611 missense probably benign 0.14
R4591:Ddn UTSW 15 98807806 missense possibly damaging 0.85
R5333:Ddn UTSW 15 98805356 missense possibly damaging 0.92
R5426:Ddn UTSW 15 98806466 missense possibly damaging 0.93
R5494:Ddn UTSW 15 98807003 missense probably damaging 0.96
R6260:Ddn UTSW 15 98805854 missense possibly damaging 0.77
R7286:Ddn UTSW 15 98806025 missense possibly damaging 0.71
R7467:Ddn UTSW 15 98805366 missense possibly damaging 0.85
Z1088:Ddn UTSW 15 98806139 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTGACCCAGGGACTCTTTC -3'
(R):5'- TCTACCGGGATGTTCTAGGAGC -3'

Sequencing Primer
(F):5'- GGACTCTTTCCACCCGGTG -3'
(R):5'- AGCTTGGGGTCTCAGACAG -3'
Posted On2016-07-06