Incidental Mutation 'R5249:Pum1'
ID398760
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Namepumilio RNA-binding family member 1
SynonymsPumm
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130663321-130781564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130762814 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 699 (Y699F)
Ref Sequence ENSEMBL: ENSMUSP00000101613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992]
Predicted Effect probably benign
Transcript: ENSMUST00000030315
AA Change: Y796F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: Y796F

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082550
Predicted Effect probably benign
Transcript: ENSMUST00000097862
AA Change: Y795F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: Y795F

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097864
AA Change: Y795F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: Y795F

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105991
AA Change: Y553F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: Y553F

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105992
AA Change: Y699F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: Y699F

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154720
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130743789 missense probably damaging 1.00
IGL01327:Pum1 APN 4 130730543 missense probably damaging 0.97
IGL01360:Pum1 APN 4 130728170 intron probably benign
IGL02055:Pum1 APN 4 130754054 missense probably benign 0.19
IGL02713:Pum1 APN 4 130766012 missense probably damaging 1.00
IGL03401:Pum1 APN 4 130743681 splice site probably benign
LCD18:Pum1 UTSW 4 130730549 intron probably benign
R0077:Pum1 UTSW 4 130772674 missense probably benign 0.06
R0346:Pum1 UTSW 4 130779805 missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130728104 missense probably benign 0.34
R0870:Pum1 UTSW 4 130768844 missense probably damaging 0.99
R1006:Pum1 UTSW 4 130771888 missense probably damaging 0.98
R1300:Pum1 UTSW 4 130765961 missense probably damaging 1.00
R1499:Pum1 UTSW 4 130719256 missense probably damaging 1.00
R1572:Pum1 UTSW 4 130718204 missense probably damaging 0.99
R1835:Pum1 UTSW 4 130701048 missense possibly damaging 0.93
R1864:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130718218 missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130774434 missense probably benign 0.02
R2119:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130751491 missense probably damaging 1.00
R2164:Pum1 UTSW 4 130728083 nonsense probably null
R2164:Pum1 UTSW 4 130728084 missense probably damaging 0.99
R2280:Pum1 UTSW 4 130766011 missense probably damaging 1.00
R3116:Pum1 UTSW 4 130772660 missense probably damaging 1.00
R3890:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3891:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3892:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R4134:Pum1 UTSW 4 130764069 missense probably damaging 1.00
R4258:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R4731:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4732:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4733:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4973:Pum1 UTSW 4 130669137 missense probably benign 0.27
R5198:Pum1 UTSW 4 130779879 nonsense probably null
R5478:Pum1 UTSW 4 130751484 missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130764127 missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130730366 missense probably benign 0.04
R6008:Pum1 UTSW 4 130768847 missense probably damaging 1.00
R6112:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R6416:Pum1 UTSW 4 130728287 splice site probably null
R6426:Pum1 UTSW 4 130753972 missense probably damaging 1.00
R6431:Pum1 UTSW 4 130774505 missense probably damaging 1.00
R7226:Pum1 UTSW 4 130771981 missense probably damaging 1.00
R7273:Pum1 UTSW 4 130751480 missense probably damaging 0.99
R7423:Pum1 UTSW 4 130774545 missense probably damaging 1.00
R7491:Pum1 UTSW 4 130719174 missense probably benign 0.08
R7526:Pum1 UTSW 4 130747026 missense probably damaging 0.99
R7731:Pum1 UTSW 4 130762963 missense probably benign 0.29
R7911:Pum1 UTSW 4 130774477 missense probably benign 0.40
R8065:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R8067:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R8305:Pum1 UTSW 4 130771920 missense probably benign 0.02
R8476:Pum1 UTSW 4 130752713 missense possibly damaging 0.91
X0024:Pum1 UTSW 4 130779790 missense probably benign 0.00
Z1177:Pum1 UTSW 4 130751479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGATGATAGCTCAGTGACATAGG -3'
(R):5'- AGAGCCATGCTGGTCTTGAG -3'

Sequencing Primer
(F):5'- TGATAGCTCAGTGACATAGGAGGAG -3'
(R):5'- GCCATGCTGGTCTTGAGAAAATTCC -3'
Posted On2016-07-06