Incidental Mutation 'R5249:Mtor'
ID398763
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 042820-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148463732 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 485 (C485S)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably damaging
Transcript: ENSMUST00000103221
AA Change: C485S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: C485S

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAATAATCTCTACACTCACTTGTGG -3'
(R):5'- CCAGGAGTAACATGCATGCC -3'

Sequencing Primer
(F):5'- ACACTCACTTGTGGCTGGC -3'
(R):5'- CTTCTTTTTCAGATGAGAGAGCC -3'
Posted On2016-07-06