Incidental Mutation 'R5172:Cfc1'
ID 398773
Institutional Source Beutler Lab
Gene Symbol Cfc1
Ensembl Gene ENSMUSG00000026124
Gene Name cripto, FRL-1, cryptic family 1
Synonyms cryptic, b2b970Clo
MMRRC Submission 042752-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock # R5172 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 34535648-34544313 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34535930 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 10 (I10F)
Ref Sequence ENSEMBL: ENSMUSP00000027298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027298]
AlphaFold P97766
Predicted Effect probably benign
Transcript: ENSMUST00000027298
AA Change: I10F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027298
Gene: ENSMUSG00000026124
AA Change: I10F

DomainStartEndE-ValueType
Blast:EGF 74 123 2e-11 BLAST
SCOP:d1autl1 99 125 2e-5 SMART
Pfam:CFC 131 165 4.7e-17 PFAM
low complexity region 186 195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189108
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted null mutations of this gene result in left-right laterality defects, including randomization of abdominal situs, asplenia or severe hyposplenia, pulmonary right isomerism, randomized embryo turning and cardiac looping, and postnatal death due tocomplex cardiac malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,375,608 Y52C probably damaging Het
Acmsd C T 1: 127,753,848 R183* probably null Het
Anxa2 T A 9: 69,485,251 D127E probably damaging Het
Atrnl1 T A 19: 57,685,513 Y593* probably null Het
Atxn2 C T 5: 121,795,035 probably null Het
Ccl6 A T 11: 83,589,343 Y66N probably damaging Het
Ccng1 A G 11: 40,751,286 V223A probably benign Het
Cfap44 T C 16: 44,449,193 Y1187H probably benign Het
Chrne T A 11: 70,615,526 T365S probably benign Het
Clec4b1 G T 6: 123,071,455 R183L probably benign Het
Csmd2 A C 4: 128,477,397 Q1926P probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dzip1 T A 14: 118,887,151 Q570L probably damaging Het
Fam149a T A 8: 45,344,653 Q507L probably damaging Het
Frem3 T C 8: 80,612,566 V496A probably benign Het
Fryl A T 5: 73,101,673 D589E possibly damaging Het
Hemk1 T C 9: 107,329,432 E4G possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnh7 T C 2: 62,739,164 D796G possibly damaging Het
Lemd2 G T 17: 27,195,382 S326* probably null Het
Mdc1 T C 17: 35,853,090 S1177P probably benign Het
Mfsd4b4 A G 10: 39,894,087 F78S probably damaging Het
Mmgt2 T A 11: 62,665,128 F101I possibly damaging Het
Myo18a T C 11: 77,824,098 L785P probably damaging Het
Nup155 C A 15: 8,109,542 Q33K probably benign Het
Olfr1152 A G 2: 87,868,827 T279A probably benign Het
Olfr584 T C 7: 103,085,677 L48P probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank1 A T 19: 34,840,802 C112* probably null Het
Pcmtd1 T A 1: 7,163,261 M23K probably benign Het
Rere A T 4: 150,570,269 R419S unknown Het
Rpf1 T C 3: 146,512,295 R155G possibly damaging Het
Sema7a A G 9: 57,957,678 T421A probably benign Het
Sharpin A G 15: 76,347,541 S323P probably benign Het
Slamf6 A G 1: 171,936,580 E180G probably benign Het
Snd1 T G 6: 28,886,616 V874G possibly damaging Het
Sult6b2 A T 6: 142,797,931 V123D probably damaging Het
Tpk1 A T 6: 43,560,017 probably null Het
Vmn1r160 A T 7: 22,871,336 N38I probably damaging Het
Wdr93 T A 7: 79,752,493 I180N probably damaging Het
Ythdf3 C T 3: 16,204,034 T119I probably damaging Het
Zc3h18 T G 8: 122,407,420 probably benign Het
Other mutations in Cfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Cfc1 APN 1 34537122 splice site probably benign
R0414:Cfc1 UTSW 1 34537328 missense probably damaging 0.97
R0522:Cfc1 UTSW 1 34537153 missense probably damaging 1.00
R1620:Cfc1 UTSW 1 34536473 missense possibly damaging 0.87
R1739:Cfc1 UTSW 1 34537234 missense probably damaging 1.00
R3417:Cfc1 UTSW 1 34536376 nonsense probably null
R4440:Cfc1 UTSW 1 34544102 utr 3 prime probably benign
R7139:Cfc1 UTSW 1 34536479 missense probably benign 0.00
R9332:Cfc1 UTSW 1 34537372 missense probably damaging 1.00
R9618:Cfc1 UTSW 1 34536479 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGGGCAGAGACATCTTC -3'
(R):5'- TACAGTCAGTCTAAGCGCAGTTC -3'

Sequencing Primer
(F):5'- AGGGCAGAGACATCTTCATCTTGC -3'
(R):5'- GTCTAAGCGCAGTTCACACATC -3'
Posted On 2016-07-06