Incidental Mutation 'R5249:Otud7a'
ID398800
Institutional Source Beutler Lab
Gene Symbol Otud7a
Ensembl Gene ENSMUSG00000033510
Gene NameOTU domain containing 7A
SynonymsCezanne 2 protein, Otud7
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location63444751-63759028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63757433 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 495 (N495D)
Ref Sequence ENSEMBL: ENSMUSP00000057282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058476] [ENSMUST00000177511] [ENSMUST00000177534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058476
AA Change: N495D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057282
Gene: ENSMUSG00000033510
AA Change: N495D

DomainStartEndE-ValueType
PDB:2L2D|A 11 82 4e-43 PDB
Pfam:OTU 207 371 1.5e-26 PFAM
low complexity region 478 510 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 559 581 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 730 777 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 865 872 N/A INTRINSIC
Pfam:zf-A20 888 912 4.3e-9 PFAM
Predicted Effect silent
Transcript: ENSMUST00000177511
SMART Domains Protein: ENSMUSP00000134821
Gene: ENSMUSG00000033510

DomainStartEndE-ValueType
transmembrane domain 36 55 N/A INTRINSIC
low complexity region 56 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177534
AA Change: N501D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135559
Gene: ENSMUSG00000033510
AA Change: N501D

DomainStartEndE-ValueType
Pfam:UBA_4 28 66 2e-7 PFAM
Pfam:OTU 206 377 5.7e-32 PFAM
low complexity region 484 516 N/A INTRINSIC
low complexity region 533 553 N/A INTRINSIC
low complexity region 565 587 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinizing enzyme and possible tumor suppressor. The encoded protein acts on TNF receptor associated factor 6 (TRAF6) to control nuclear factor kappa B expression. However, this gene is downregulated by SNAIL1 in hepatocellular carcinoma cells, contributing to their progression and malignancy. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal spike wave discharge, decreased dendritic spine density, decreased prepulse inhibition, impaired coordination, decreased grip strength, decreased startle reflex, impaired ultrasonic vocalization and delayed tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Otud7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:Otud7a UTSW 7 63735801 missense probably benign 0.32
R0241:Otud7a UTSW 7 63697244 splice site probably benign
R0576:Otud7a UTSW 7 63685518 missense possibly damaging 0.93
R0594:Otud7a UTSW 7 63727472 nonsense probably null
R0611:Otud7a UTSW 7 63735890 missense possibly damaging 0.84
R1473:Otud7a UTSW 7 63754629 splice site probably benign
R1519:Otud7a UTSW 7 63758643 missense probably damaging 1.00
R1694:Otud7a UTSW 7 63733710 missense probably damaging 1.00
R1941:Otud7a UTSW 7 63729826 nonsense probably null
R1952:Otud7a UTSW 7 63650876 missense probably damaging 0.96
R2199:Otud7a UTSW 7 63757656 missense possibly damaging 0.53
R2404:Otud7a UTSW 7 63697151 missense probably benign 0.20
R4238:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4239:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4294:Otud7a UTSW 7 63697191 missense probably damaging 0.99
R4512:Otud7a UTSW 7 63729877 missense probably benign 0.32
R4748:Otud7a UTSW 7 63735915 missense possibly damaging 0.73
R4815:Otud7a UTSW 7 63729910 critical splice donor site probably null
R4942:Otud7a UTSW 7 63757423 missense probably damaging 0.99
R5332:Otud7a UTSW 7 63735826 missense probably damaging 0.98
R5438:Otud7a UTSW 7 63757459 missense unknown
R6185:Otud7a UTSW 7 63758385 missense probably damaging 0.99
R7099:Otud7a UTSW 7 63757455 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGGGCTCCTATTCCATAAACACC -3'
(R):5'- TTGGCACGACCCATCTTACC -3'

Sequencing Primer
(F):5'- TTCTTGGGGCCTACACGAG -3'
(R):5'- ATCTTACCGTGCACCAGGC -3'
Posted On2016-07-06