Incidental Mutation 'R5172:Dmpk'
ID398809
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 042752-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R5172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 19088019 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 301 (L301V)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect probably benign
Transcript: ENSMUST00000154199
AA Change: L301V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,375,608 Y52C probably damaging Het
Acmsd C T 1: 127,753,848 R183* probably null Het
Anxa2 T A 9: 69,485,251 D127E probably damaging Het
Atrnl1 T A 19: 57,685,513 Y593* probably null Het
Atxn2 C T 5: 121,795,035 probably null Het
Ccl6 A T 11: 83,589,343 Y66N probably damaging Het
Ccng1 A G 11: 40,751,286 V223A probably benign Het
Cfap44 T C 16: 44,449,193 Y1187H probably benign Het
Cfc1 A T 1: 34,535,930 I10F probably benign Het
Chrne T A 11: 70,615,526 T365S probably benign Het
Clec4b1 G T 6: 123,071,455 R183L probably benign Het
Csmd2 A C 4: 128,477,397 Q1926P probably benign Het
Dzip1 T A 14: 118,887,151 Q570L probably damaging Het
Fam149a T A 8: 45,344,653 Q507L probably damaging Het
Frem3 T C 8: 80,612,566 V496A probably benign Het
Fryl A T 5: 73,101,673 D589E possibly damaging Het
Hemk1 T C 9: 107,329,432 E4G possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnh7 T C 2: 62,739,164 D796G possibly damaging Het
Lemd2 G T 17: 27,195,382 S326* probably null Het
Mdc1 T C 17: 35,853,090 S1177P probably benign Het
Mfsd4b4 A G 10: 39,894,087 F78S probably damaging Het
Mmgt2 T A 11: 62,665,128 F101I possibly damaging Het
Myo18a T C 11: 77,824,098 L785P probably damaging Het
Nup155 C A 15: 8,109,542 Q33K probably benign Het
Olfr1152 A G 2: 87,868,827 T279A probably benign Het
Olfr584 T C 7: 103,085,677 L48P probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank1 A T 19: 34,840,802 C112* probably null Het
Pcmtd1 T A 1: 7,163,261 M23K probably benign Het
Rere A T 4: 150,570,269 R419S unknown Het
Rpf1 T C 3: 146,512,295 R155G possibly damaging Het
Sema7a A G 9: 57,957,678 T421A probably benign Het
Sharpin A G 15: 76,347,541 S323P probably benign Het
Slamf6 A G 1: 171,936,580 E180G probably benign Het
Snd1 T G 6: 28,886,616 V874G possibly damaging Het
Sult6b2 A T 6: 142,797,931 V123D probably damaging Het
Tpk1 A T 6: 43,560,017 probably null Het
Vmn1r160 A T 7: 22,871,336 N38I probably damaging Het
Wdr93 T A 7: 79,752,493 I180N probably damaging Het
Ythdf3 C T 3: 16,204,034 T119I probably damaging Het
Zc3h18 T G 8: 122,407,420 probably benign Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GACTTAGTGGCTTGTGCTCC -3'
(R):5'- CTCGAAGTCTGGTGTAAAGGGG -3'

Sequencing Primer
(F):5'- TAGTGGCTTGTGCTCCCAGAC -3'
(R):5'- GGGTACACTGTCTCGGAGACC -3'
Posted On2016-07-06