Mutagenetix > Incidental Mutations

Incidental Mutation 'R0454:Itgam'

39883

Institutional Source

Beutler Lab

Gene Symbol

Itgam

Ensembl Gene

ENSMUSG00000030786

Gene Name

integrin alpha M

Synonyms

Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3

MMRRC Submission

038654-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R0454 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128062640-128118491 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128107980 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 660 (N660I)

Ref Sequence

ENSEMBL: ENSMUSP00000101849 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]

Predicted Effect

probably benign
Transcript: ENSMUST00000064821
AA Change: N661I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: N661I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
Pfam:Integrin_alpha	1130	1144	2.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098015
AA Change: N660I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: N660I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106240
AA Change: N543I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: N543I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	462	516	3.67e-3	SMART
low complexity region	732	738	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106242
AA Change: N660I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: N660I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
Pfam:Integrin_alpha	1131	1145	8.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120355
AA Change: N661I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: N661I

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	511	5.91e-7	SMART
Int_alpha	517	573	4.9e-13	SMART
Int_alpha	580	634	3.67e-3	SMART
low complexity region	850	856	N/A	INTRINSIC
low complexity region	1141	1150	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	A	G	5: 118,255,821	E88G	possibly damaging	Het
4930447F04Rik	T	C	X: 66,303,668	E91G	unknown	Het
Acot1	A	G	12: 84,017,339	Q407R	probably benign	Het
Adcy10	T	A	1: 165,570,728	Y1465N	probably damaging	Het
Ahsa2	T	A	11: 23,490,702	I249F	probably damaging	Het
Arhgap10	T	C	8: 77,250,965	N721S	probably damaging	Het
Arrdc4	T	G	7: 68,741,871	E216A	probably damaging	Het
Axin1	T	C	17: 26,173,663	V306A	probably benign	Het
BC005561	T	G	5: 104,518,211	S200A	probably benign	Het
Cct3	T	C	3: 88,302,866		probably null	Het
Cfap58	G	A	19: 47,974,680		probably null	Het
Chd9	T	C	8: 90,973,231	S49P	possibly damaging	Het
Clcn2	C	A	16: 20,710,428		probably null	Het
Col26a1	T	C	5: 136,754,193	N286D	probably benign	Het
Cpt1b	T	A	15: 89,424,393	I111F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,087	I30N	probably damaging	Het
Ddc	T	G	11: 11,880,587	D19A	possibly damaging	Het
Depdc1a	T	A	3: 159,516,900		probably null	Het
Evc2	T	A	5: 37,417,484	C1028S	possibly damaging	Het
Fam228a	T	C	12: 4,731,457	E134G	probably damaging	Het
Fasl	T	C	1: 161,787,954	E111G	probably benign	Het
Fbxw10	A	G	11: 62,876,738	N800S	possibly damaging	Het
Fras1	T	C	5: 96,762,665	S3318P	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gad1	T	A	2: 70,579,201	M212K	probably damaging	Het
Gm17455	T	G	10: 60,402,973	S6A	probably benign	Het
Grm5	T	C	7: 88,130,789	S1146P	probably damaging	Het
Gsn	T	C	2: 35,304,639	L649P	probably damaging	Het
H2-DMb1	A	G	17: 34,155,711	T112A	probably benign	Het
Hcn3	T	A	3: 89,152,894	I148F	probably damaging	Het
Hdac10	T	C	15: 89,125,758		probably null	Het
Hk3	C	A	13: 55,008,705	D619Y	probably damaging	Het
Ifi44	T	A	3: 151,745,497	R272S	possibly damaging	Het
Il1rap	A	C	16: 26,698,875	D275A	probably damaging	Het
Itpr3	T	C	17: 27,113,819	M1853T	probably benign	Het
Lrmp	A	G	6: 145,167,984	R293G	possibly damaging	Het
Lrrc8c	A	C	5: 105,607,099	K247Q	probably damaging	Het
Map3k21	T	C	8: 125,942,119	S815P	probably benign	Het
Mast4	A	G	13: 102,751,560	S1114P	probably damaging	Het
Myh8	C	T	11: 67,303,765	Q1601*	probably null	Het
Nhlrc2	A	G	19: 56,570,527	D148G	probably damaging	Het
Nos1	T	A	5: 117,943,320	S1196T	probably benign	Het
Nsmaf	C	T	4: 6,424,874		probably null	Het
Obscn	T	C	11: 58,999,623	D7361G	unknown	Het
Olfr1350	C	T	7: 6,570,360	A123V	probably damaging	Het
Olfr600	C	A	7: 103,346,878	A17S	probably benign	Het
Olfr721-ps1	T	C	14: 14,407,777	V183A	probably damaging	Het
Pank3	T	G	11: 35,777,709	M175R	probably benign	Het
Papolg	A	G	11: 23,879,868		probably null	Het
Pcdhb21	G	A	18: 37,514,513	D232N	probably damaging	Het
Pcdhb22	T	C	18: 37,518,872	F131S	probably damaging	Het
Pik3r6	G	A	11: 68,528,782	A140T	possibly damaging	Het
Pinlyp	T	C	7: 24,542,522	T87A	possibly damaging	Het
Pld1	T	C	3: 28,124,575	S873P	probably damaging	Het
Pld5	T	A	1: 176,274,729	Y49F	probably benign	Het
Polq	T	C	16: 37,034,890	V449A	probably damaging	Het
Prkca	A	G	11: 107,978,280	V69A	probably benign	Het
Ptk6	A	G	2: 181,202,282	S75P	possibly damaging	Het
Ptprq	G	A	10: 107,582,530	Q1662*	probably null	Het
Ptprt	C	A	2: 161,553,822	A1144S	probably damaging	Het
Rrm1	T	A	7: 102,466,926	W684R	probably damaging	Het
Ryr1	T	A	7: 29,036,075	M4093L	probably damaging	Het
Scnn1a	C	T	6: 125,322,226	L90F	probably damaging	Het
Slc25a19	G	T	11: 115,617,597	Y188*	probably null	Het
Slc31a1	C	T	4: 62,385,629		probably benign	Het
Slc5a11	C	G	7: 123,265,235	S351R	possibly damaging	Het
Slc6a17	A	G	3: 107,476,867	L387P	probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Spam1	T	A	6: 24,797,838	L331Q	probably damaging	Het
Spata32	A	G	11: 103,209,299	W127R	probably damaging	Het
Spta1	T	G	1: 174,213,942	I1324S	probably damaging	Het
St6galnac4	A	G	2: 32,594,318	Y176C	probably damaging	Het
Stk10	A	G	11: 32,596,724	E327G	probably damaging	Het
Stxbp5l	T	A	16: 37,134,284	Y912F	possibly damaging	Het
Tchp	G	A	5: 114,720,182	E459K	probably benign	Het
Terf2	C	T	8: 107,096,210	W100*	probably null	Het
Thrsp	T	C	7: 97,417,427	N26S	probably damaging	Het
Tln1	C	A	4: 43,553,504	R297L	probably benign	Het
Tmeff2	C	A	1: 50,928,075	T43N	possibly damaging	Het
Tmx1	C	T	12: 70,453,173	A2V	possibly damaging	Het
Tnks1bp1	T	A	2: 85,072,137	L1053Q	probably damaging	Het
Trmt10b	A	T	4: 45,304,286	K107N	probably damaging	Het
Trpa1	A	T	1: 14,885,748		probably null	Het
Trrap	A	G	5: 144,846,477	K3371R	probably damaging	Het
Tuba3b	G	A	6: 145,618,269	V14I	probably benign	Het
Usp19	T	C	9: 108,494,240		probably null	Het
Usp28	C	A	9: 49,039,101	D615E	possibly damaging	Het
Utp20	T	C	10: 88,822,069	D43G	probably benign	Het
Vmn1r58	T	G	7: 5,410,998	K78Q	possibly damaging	Het
Vmn2r10	T	C	5: 109,003,461	M96V	probably benign	Het
Wdr90	T	C	17: 25,860,049	E273G	probably damaging	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zscan21	T	C	5: 138,133,603	I463T	possibly damaging	Het

Other mutations in Itgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Itgam	APN	7	128085661	missense	probably damaging	1.00
IGL00983:Itgam	APN	7	128068667	missense	probably damaging	0.97
IGL01102:Itgam	APN	7	128080273	missense	possibly damaging	0.94
IGL01615:Itgam	APN	7	128116767	missense	possibly damaging	0.80
IGL01845:Itgam	APN	7	128112472	missense	probably damaging	1.00
IGL01860:Itgam	APN	7	128070943	missense	probably benign	0.03
IGL01874:Itgam	APN	7	128115166	missense	probably damaging	0.97
IGL01910:Itgam	APN	7	128083776	missense	probably damaging	1.00
IGL01994:Itgam	APN	7	128101727	missense	probably damaging	0.97
IGL02332:Itgam	APN	7	128085674	critical splice donor site	probably null
IGL02348:Itgam	APN	7	128116300	missense	possibly damaging	0.52
IGL02394:Itgam	APN	7	128084942	missense	probably benign	0.01
IGL02491:Itgam	APN	7	128116018	missense	possibly damaging	0.71
IGL02695:Itgam	APN	7	128085941	missense	possibly damaging	0.81
IGL02821:Itgam	APN	7	128076109	missense	probably damaging	0.99
IGL02970:Itgam	APN	7	128086043	missense	probably benign	0.00
IGL03145:Itgam	APN	7	128113019	missense	probably benign	0.12
adhesion	UTSW	7	128101537	missense	probably damaging	0.99
apparition	UTSW	7	128112286	splice site	probably null
attachment	UTSW	7	128113033	missense	probably damaging	1.00
Follower	UTSW	7	128080264	missense	probably damaging	1.00
invisible	UTSW	7	128070703	unclassified	probably null
obscured	UTSW	7	128081634	missense	probably damaging	1.00
R0184:Itgam	UTSW	7	128086058	missense	probably damaging	0.96
R0389:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0443:Itgam	UTSW	7	128081634	missense	probably damaging	1.00
R0674:Itgam	UTSW	7	128116218	missense	possibly damaging	0.67
R0828:Itgam	UTSW	7	128116505	critical splice donor site	probably null
R0925:Itgam	UTSW	7	128112238	missense	probably benign	0.00
R1086:Itgam	UTSW	7	128080264	missense	probably damaging	1.00
R1655:Itgam	UTSW	7	128115163	missense	probably benign	0.00
R1809:Itgam	UTSW	7	128070937	missense	possibly damaging	0.62
R1823:Itgam	UTSW	7	128064732	missense	probably benign	0.04
R2105:Itgam	UTSW	7	128081712	missense	probably damaging	1.00
R2154:Itgam	UTSW	7	128085577	missense	probably damaging	0.99
R2656:Itgam	UTSW	7	128116815	missense	probably null	1.00
R2913:Itgam	UTSW	7	128112406	missense	probably damaging	1.00
R3116:Itgam	UTSW	7	128116029	missense	probably damaging	1.00
R3404:Itgam	UTSW	7	128070703	unclassified	probably null
R3821:Itgam	UTSW	7	128112286	splice site	probably null
R3822:Itgam	UTSW	7	128112286	splice site	probably null
R3960:Itgam	UTSW	7	128115175	missense	probably benign	0.02
R3968:Itgam	UTSW	7	128113033	missense	probably damaging	1.00
R4192:Itgam	UTSW	7	128064732	missense	probably benign	0.21
R4400:Itgam	UTSW	7	128081658	missense	probably damaging	1.00
R4708:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4709:Itgam	UTSW	7	128101537	missense	probably damaging	0.99
R4742:Itgam	UTSW	7	128113073	missense	probably damaging	1.00
R4790:Itgam	UTSW	7	128116273	missense	probably benign	0.01
R4960:Itgam	UTSW	7	128115840	missense	possibly damaging	0.93
R5109:Itgam	UTSW	7	128113218	missense	probably benign	0.06
R5190:Itgam	UTSW	7	128116317	unclassified	probably null
R5379:Itgam	UTSW	7	128112388	missense	probably damaging	1.00
R5386:Itgam	UTSW	7	128107980	missense	probably benign	0.00
R6104:Itgam	UTSW	7	128116302	missense	possibly damaging	0.85
R6122:Itgam	UTSW	7	128085652	missense	probably damaging	0.99
R6189:Itgam	UTSW	7	128112504	missense	probably benign	0.04
R6282:Itgam	UTSW	7	128084942	missense	probably benign	0.01
R6545:Itgam	UTSW	7	128107872	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTAACTGAGCCACAGACTTCTC -3'
(R):5'- GCTGTCCCATTCATTCTAGCCAGG -3'

Sequencing Primer
(F):5'- TAAGGATCTCACAATGGATGGCTTG -3'
(R):5'- CATTCTAGCCAGGCTTAAAAAGG -3'

Posted On

2013-05-23