Incidental Mutation 'R5249:Ap1b1'
ID398846
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R5249 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5026364 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 437 (E437G)
Ref Sequence ENSEMBL: ENSMUSP00000105523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009234
AA Change: E464G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: E464G

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101613
AA Change: E437G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: E437G

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109897
AA Change: E437G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: E437G

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145704
Meta Mutation Damage Score 0.6881 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 5032464 missense probably benign
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R1529:Ap1b1 UTSW 11 5039547 missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 splice site probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 5016760 missense probably damaging 1.00
R4710:Ap1b1 UTSW 11 5031664 missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R6014:Ap1b1 UTSW 11 5019364 missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
R8291:Ap1b1 UTSW 11 5018027 missense probably damaging 1.00
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGGGAAGCTGCATGTC -3'
(R):5'- CTAACTTCGTCTCTTCTGGAAGTG -3'

Sequencing Primer
(F):5'- CTTCATTGGTGCTCACGTACTGG -3'
(R):5'- CTGGAAGTGCTAGCTCAGTAC -3'
Posted On2016-07-06