Incidental Mutation 'R5173:Ptprt'
ID398872
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
MMRRC Submission 042753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5173 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161927756 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 396 (N396K)
Ref Sequence ENSEMBL: ENSMUSP00000105071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably benign
Transcript: ENSMUST00000109441
AA Change: N396K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: N396K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109442
AA Change: N396K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: N396K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109443
AA Change: N396K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: N396K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109445
AA Change: N396K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: N396K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,100,567 R54* probably null Het
Abca13 AC A 11: 9,682,032 probably null Het
Abca6 A T 11: 110,191,720 F1142L probably benign Het
Ap1g1 T A 8: 109,851,132 probably null Het
Apob T C 12: 8,008,238 V2207A probably benign Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Chd3 A G 11: 69,369,243 probably benign Het
Coch C A 12: 51,596,507 Y103* probably null Het
Cul3 A T 1: 80,281,416 D382E possibly damaging Het
Cul5 T C 9: 53,642,734 T291A probably benign Het
Dab1 T C 4: 104,688,448 probably null Het
Dmtf1 A G 5: 9,140,356 probably benign Het
Dpp4 T C 2: 62,387,130 Y41C probably damaging Het
Eif2ak4 A G 2: 118,408,360 I45M probably damaging Het
Epn3 T C 11: 94,496,097 K149R probably damaging Het
Flnc A G 6: 29,455,538 E2029G probably damaging Het
Gm5799 A G 14: 43,544,659 N96S probably damaging Het
Gm9573 G T 17: 35,620,741 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grik5 T C 7: 25,062,894 H224R possibly damaging Het
Lpar6 A T 14: 73,239,097 E166V probably benign Het
Mical1 T C 10: 41,484,989 L683P probably damaging Het
Mis18bp1 T C 12: 65,149,375 I538M possibly damaging Het
Mobp A G 9: 120,168,245 R77G possibly damaging Het
Mylk A G 16: 34,977,013 H1614R probably benign Het
Olfr1179 G A 2: 88,402,922 T4I probably benign Het
Olfr1388 T C 11: 49,443,886 F12L probably benign Het
Olfr371 T C 8: 85,230,576 L27P probably damaging Het
Osbpl1a C T 18: 12,762,640 V390I probably benign Het
Pcdha7 C A 18: 36,974,652 D243E probably benign Het
Pi4ka A T 16: 17,350,906 N653K possibly damaging Het
Plin5 T G 17: 56,115,548 probably null Het
Plod1 A G 4: 147,916,301 probably benign Het
Psd3 T C 8: 67,696,989 K372E probably damaging Het
Psmd11 C T 11: 80,460,740 T263I probably benign Het
Rab39 T C 9: 53,686,500 E155G probably damaging Het
Rimbp2 T C 5: 128,797,648 D293G probably benign Het
Rnf220 T C 4: 117,289,274 probably benign Het
Rnmt C T 18: 68,321,359 probably benign Het
Slc10a1 T A 12: 80,956,028 I279F probably damaging Het
Taar6 A G 10: 23,985,352 Y99H probably damaging Het
Tas2r144 T A 6: 42,216,114 F263I probably benign Het
Tex15 T A 8: 33,571,740 N399K possibly damaging Het
Tlr9 T A 9: 106,225,952 V814D possibly damaging Het
Tmem53 T A 4: 117,265,711 probably benign Het
Ubap2l T C 3: 90,021,030 I511V possibly damaging Het
Vmn2r60 T C 7: 42,195,511 M766T probably damaging Het
Zfp462 T C 4: 55,011,115 V1027A probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162278085 missense probably damaging 1.00
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGTCTGATGGTCATGAAGGGC -3'
(R):5'- AGACCTGTGTGCTTCAATAGG -3'

Sequencing Primer
(F):5'- TCATGAAGGGCCGTAGACC -3'
(R):5'- CTGTTAATTATGCTGCAGGT -3'
Posted On2016-07-06