Incidental Mutation 'R5249:Srpk3'
ID398893
Institutional Source Beutler Lab
Gene Symbol Srpk3
Ensembl Gene ENSMUSG00000002007
Gene Nameserine/arginine-rich protein specific kinase 3
SynonymsStk23, Mssk1
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5249 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location73774405-73778925 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 73774949 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 82 (R82*)
Ref Sequence ENSEMBL: ENSMUSP00000002081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002079] [ENSMUST00000002081] [ENSMUST00000052761]
Predicted Effect probably benign
Transcript: ENSMUST00000002079
SMART Domains Protein: ENSMUSP00000002079
Gene: ENSMUSG00000031385

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Sema 44 445 5.53e-102 SMART
PSI 463 515 8.91e-10 SMART
Blast:Sema 533 592 2e-9 BLAST
PSI 609 671 8.95e-1 SMART
PSI 776 822 5e-1 SMART
IPT 823 914 7.15e-15 SMART
IPT 915 1001 5.63e-13 SMART
IPT 1003 1134 7.17e-1 SMART
Pfam:TIG 1148 1232 7.7e-7 PFAM
low complexity region 1246 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1317 1869 2.7e-225 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000002081
AA Change: R82*
SMART Domains Protein: ENSMUSP00000002081
Gene: ENSMUSG00000002007
AA Change: R82*

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
Pfam:Pkinase 78 228 1.4e-22 PFAM
Pfam:Pkinase_Tyr 78 230 1.1e-9 PFAM
coiled coil region 260 300 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 341 360 N/A INTRINSIC
Pfam:Pkinase 385 563 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052761
SMART Domains Protein: ENSMUSP00000056502
Gene: ENSMUSG00000002010

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Iso_dh 56 379 1.1e-141 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156299
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase similar to a protein kinase which is specific for the SR (serine/arginine-rich domain) family of splicing factors. A highly similar protein has been shown to play a role in muscle development in mice. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mice exhibit defects in skeletal muscle growth and myopathy of type 2 muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Srpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Srpk3 APN X 73775148 missense probably benign 0.33
Myo_bone UTSW X 73774949 nonsense probably null
R1822:Srpk3 UTSW X 73777955 missense possibly damaging 0.79
R1823:Srpk3 UTSW X 73777955 missense possibly damaging 0.79
R4601:Srpk3 UTSW X 73774941 missense possibly damaging 0.47
R4611:Srpk3 UTSW X 73774941 missense possibly damaging 0.47
R5246:Srpk3 UTSW X 73774949 nonsense probably null
R5247:Srpk3 UTSW X 73774949 nonsense probably null
R5248:Srpk3 UTSW X 73774949 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATTGCAAGGGTAAGGCCTGG -3'
(R):5'- CACTTTCAGGGCCACAAAGC -3'

Sequencing Primer
(F):5'- CAAGGGCTCAGGACAGCTTG -3'
(R):5'- AAAGCGCTTGCGCCTGTAATATG -3'
Posted On2016-07-06