Mutagenetix > Incidental Mutation

Incidental Mutation 'R5173:Tlr9'

398909

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

042753-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R5173 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106225952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 814 (V814D)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062241
AA Change: V814D

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: V814D

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	G	A	1: 85,100,567	R54*	probably null	Het
Abca13	AC	A	11: 9,682,032		probably null	Het
Abca6	A	T	11: 110,191,720	F1142L	probably benign	Het
Ap1g1	T	A	8: 109,851,132		probably null	Het
Apob	T	C	12: 8,008,238	V2207A	probably benign	Het
Cenpp	CAAACCTGAAAA	CAAA	13: 49,464,782		probably null	Het
Chd3	A	G	11: 69,369,243		probably benign	Het
Coch	C	A	12: 51,596,507	Y103*	probably null	Het
Cul3	A	T	1: 80,281,416	D382E	possibly damaging	Het
Cul5	T	C	9: 53,642,734	T291A	probably benign	Het
Dab1	T	C	4: 104,688,448		probably null	Het
Dmtf1	A	G	5: 9,140,356		probably benign	Het
Dpp4	T	C	2: 62,387,130	Y41C	probably damaging	Het
Eif2ak4	A	G	2: 118,408,360	I45M	probably damaging	Het
Epn3	T	C	11: 94,496,097	K149R	probably damaging	Het
Flnc	A	G	6: 29,455,538	E2029G	probably damaging	Het
Gm5799	A	G	14: 43,544,659	N96S	probably damaging	Het
Gm9573	G	T	17: 35,620,741		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grik5	T	C	7: 25,062,894	H224R	possibly damaging	Het
Lpar6	A	T	14: 73,239,097	E166V	probably benign	Het
Mical1	T	C	10: 41,484,989	L683P	probably damaging	Het
Mis18bp1	T	C	12: 65,149,375	I538M	possibly damaging	Het
Mobp	A	G	9: 120,168,245	R77G	possibly damaging	Het
Mylk	A	G	16: 34,977,013	H1614R	probably benign	Het
Olfr1179	G	A	2: 88,402,922	T4I	probably benign	Het
Olfr1388	T	C	11: 49,443,886	F12L	probably benign	Het
Olfr371	T	C	8: 85,230,576	L27P	probably damaging	Het
Osbpl1a	C	T	18: 12,762,640	V390I	probably benign	Het
Pcdha7	C	A	18: 36,974,652	D243E	probably benign	Het
Pi4ka	A	T	16: 17,350,906	N653K	possibly damaging	Het
Plin5	T	G	17: 56,115,548		probably null	Het
Plod1	A	G	4: 147,916,301		probably benign	Het
Psd3	T	C	8: 67,696,989	K372E	probably damaging	Het
Psmd11	C	T	11: 80,460,740	T263I	probably benign	Het
Ptprt	A	T	2: 161,927,756	N396K	probably benign	Het
Rab39	T	C	9: 53,686,500	E155G	probably damaging	Het
Rimbp2	T	C	5: 128,797,648	D293G	probably benign	Het
Rnf220	T	C	4: 117,289,274		probably benign	Het
Rnmt	C	T	18: 68,321,359		probably benign	Het
Slc10a1	T	A	12: 80,956,028	I279F	probably damaging	Het
Taar6	A	G	10: 23,985,352	Y99H	probably damaging	Het
Tas2r144	T	A	6: 42,216,114	F263I	probably benign	Het
Tex15	T	A	8: 33,571,740	N399K	possibly damaging	Het
Tmem53	T	A	4: 117,265,711		probably benign	Het
Ubap2l	T	C	3: 90,021,030	I511V	possibly damaging	Het
Vmn2r60	T	C	7: 42,195,511	M766T	probably damaging	Het
Zfp462	T	C	4: 55,011,115	V1027A	probably damaging	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
R9581:Tlr9	UTSW	9	106224311	missense	probably damaging	1.00
R9689:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R9697:Tlr9	UTSW	9	106223524	nonsense	probably null
R9788:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGAAGCAACCCTCTGCACTG -3'
(R):5'- GCAGCTCGTTATACACCCAG -3'

Sequencing Primer
(F):5'- CTCTGCACTGTGCCTGTGG -3'
(R):5'- TGTGCCTTATCGAACACCACG -3'

Posted On

2016-07-06