Incidental Mutation 'R5173:Taar6'
ID398913
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Nametrace amine-associated receptor 6
SynonymsLOC215855
MMRRC Submission 042753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5173 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23984609-23985646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23985352 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 99 (Y99H)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
Predicted Effect probably damaging
Transcript: ENSMUST00000057080
AA Change: Y99H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: Y99H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Meta Mutation Damage Score 0.1789 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,100,567 R54* probably null Het
Abca13 AC A 11: 9,682,032 probably null Het
Abca6 A T 11: 110,191,720 F1142L probably benign Het
Ap1g1 T A 8: 109,851,132 probably null Het
Apob T C 12: 8,008,238 V2207A probably benign Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Chd3 A G 11: 69,369,243 probably benign Het
Coch C A 12: 51,596,507 Y103* probably null Het
Cul3 A T 1: 80,281,416 D382E possibly damaging Het
Cul5 T C 9: 53,642,734 T291A probably benign Het
Dab1 T C 4: 104,688,448 probably null Het
Dmtf1 A G 5: 9,140,356 probably benign Het
Dpp4 T C 2: 62,387,130 Y41C probably damaging Het
Eif2ak4 A G 2: 118,408,360 I45M probably damaging Het
Epn3 T C 11: 94,496,097 K149R probably damaging Het
Flnc A G 6: 29,455,538 E2029G probably damaging Het
Gm5799 A G 14: 43,544,659 N96S probably damaging Het
Gm9573 G T 17: 35,620,741 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grik5 T C 7: 25,062,894 H224R possibly damaging Het
Lpar6 A T 14: 73,239,097 E166V probably benign Het
Mical1 T C 10: 41,484,989 L683P probably damaging Het
Mis18bp1 T C 12: 65,149,375 I538M possibly damaging Het
Mobp A G 9: 120,168,245 R77G possibly damaging Het
Mylk A G 16: 34,977,013 H1614R probably benign Het
Olfr1179 G A 2: 88,402,922 T4I probably benign Het
Olfr1388 T C 11: 49,443,886 F12L probably benign Het
Olfr371 T C 8: 85,230,576 L27P probably damaging Het
Osbpl1a C T 18: 12,762,640 V390I probably benign Het
Pcdha7 C A 18: 36,974,652 D243E probably benign Het
Pi4ka A T 16: 17,350,906 N653K possibly damaging Het
Plin5 T G 17: 56,115,548 probably null Het
Plod1 A G 4: 147,916,301 probably benign Het
Psd3 T C 8: 67,696,989 K372E probably damaging Het
Psmd11 C T 11: 80,460,740 T263I probably benign Het
Ptprt A T 2: 161,927,756 N396K probably benign Het
Rab39 T C 9: 53,686,500 E155G probably damaging Het
Rimbp2 T C 5: 128,797,648 D293G probably benign Het
Rnf220 T C 4: 117,289,274 probably benign Het
Rnmt C T 18: 68,321,359 probably benign Het
Slc10a1 T A 12: 80,956,028 I279F probably damaging Het
Tas2r144 T A 6: 42,216,114 F263I probably benign Het
Tex15 T A 8: 33,571,740 N399K possibly damaging Het
Tlr9 T A 9: 106,225,952 V814D possibly damaging Het
Tmem53 T A 4: 117,265,711 probably benign Het
Ubap2l T C 3: 90,021,030 I511V possibly damaging Het
Vmn2r60 T C 7: 42,195,511 M766T probably damaging Het
Zfp462 T C 4: 55,011,115 V1027A probably damaging Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23985508 missense probably benign 0.15
IGL00918:Taar6 APN 10 23985582 missense probably damaging 1.00
IGL01060:Taar6 APN 10 23985072 missense probably benign
IGL02608:Taar6 APN 10 23985183 missense probably benign 0.01
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0360:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0364:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0746:Taar6 UTSW 10 23985360 missense probably benign 0.43
R1637:Taar6 UTSW 10 23985181 missense probably benign 0.12
R4893:Taar6 UTSW 10 23985400 missense probably benign
R4944:Taar6 UTSW 10 23984715 missense probably damaging 1.00
R4951:Taar6 UTSW 10 23985208 missense probably benign 0.09
R5181:Taar6 UTSW 10 23984785 missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23985270 missense probably damaging 1.00
R5988:Taar6 UTSW 10 23985256 missense probably damaging 0.98
R6327:Taar6 UTSW 10 23985279 missense probably damaging 1.00
R6493:Taar6 UTSW 10 23985123 missense probably benign 0.36
R7595:Taar6 UTSW 10 23985070 missense probably benign
R7802:Taar6 UTSW 10 23985253 missense probably benign 0.02
R8053:Taar6 UTSW 10 23985246 missense possibly damaging 0.59
R8506:Taar6 UTSW 10 23985631 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCGATGCAAATTCCAGAC -3'
(R):5'- GGGTCTTGTGTGAAAACCCC -3'

Sequencing Primer
(F):5'- GACACAGACACCGTGAACTTGG -3'
(R):5'- AGGGTCATCCTCTATGCAGTC -3'
Posted On2016-07-06