Incidental Mutation 'R5250:Fgl2'
ID398927
Institutional Source Beutler Lab
Gene Symbol Fgl2
Ensembl Gene ENSMUSG00000039899
Gene Namefibrinogen-like protein 2
Synonyms
MMRRC Submission 042821-MU
Accession Numbers

Genbank: NM_008013; MGI: 103266

Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21372642-21378374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21375523 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 288 (S288G)
Ref Sequence ENSEMBL: ENSMUSP00000046131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030552] [ENSMUST00000035799] [ENSMUST00000115245]
Predicted Effect probably benign
Transcript: ENSMUST00000030552
SMART Domains Protein: ENSMUSP00000030552
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000035799
AA Change: S288G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046131
Gene: ENSMUSG00000039899
AA Change: S288G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 54 70 N/A INTRINSIC
coiled coil region 71 158 N/A INTRINSIC
FBG 201 428 1.6e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115245
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Meta Mutation Damage Score 0.2253 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted protein that is similar to the beta- and gamma-chains of fibrinogen. The carboxyl-terminus of the encoded protein consists of the fibrinogen-related domains (FRED). The encoded protein forms a tetrameric complex which is stabilized by interchain disulfide bonds. This protein may play a role in physiologic functions at mucosal sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele have unaltered type 1 immunity responses. Homozygous null mice for another allele show partial embryonic lethality, hemorrhage at implantation sites, decreased susceptibility to hepatitis virus infection and prolongedsurvival of heart grafts. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Fgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Fgl2 APN 5 21373177 missense possibly damaging 0.57
IGL01623:Fgl2 APN 5 21373177 missense possibly damaging 0.57
IGL02056:Fgl2 APN 5 21375545 missense probably damaging 0.99
IGL03128:Fgl2 APN 5 21373293 missense probably benign
A4554:Fgl2 UTSW 5 21372778 missense probably benign 0.01
R0049:Fgl2 UTSW 5 21375663 missense possibly damaging 0.95
R0049:Fgl2 UTSW 5 21375663 missense possibly damaging 0.95
R0052:Fgl2 UTSW 5 21375349 missense probably damaging 1.00
R0052:Fgl2 UTSW 5 21375349 missense probably damaging 1.00
R0149:Fgl2 UTSW 5 21375785 missense probably damaging 1.00
R0316:Fgl2 UTSW 5 21375523 missense possibly damaging 0.82
R1336:Fgl2 UTSW 5 21373183 missense possibly damaging 0.52
R1703:Fgl2 UTSW 5 21372732 missense possibly damaging 0.89
R1893:Fgl2 UTSW 5 21375671 missense probably benign 0.01
R2371:Fgl2 UTSW 5 21375818 missense probably damaging 1.00
R4803:Fgl2 UTSW 5 21375920 missense probably benign 0.00
R5422:Fgl2 UTSW 5 21375810 missense probably damaging 1.00
R6759:Fgl2 UTSW 5 21373258 missense probably benign 0.00
R7808:Fgl2 UTSW 5 21373231 missense possibly damaging 0.53
R7812:Fgl2 UTSW 5 21372898 missense probably benign 0.01
R7838:Fgl2 UTSW 5 21372754 missense probably benign 0.01
R7921:Fgl2 UTSW 5 21372754 missense probably benign 0.01
X0017:Fgl2 UTSW 5 21375652 missense probably damaging 0.98
X0026:Fgl2 UTSW 5 21375713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACAGCAGCTTTGAGGTC -3'
(R):5'- GGTACCGATCGTTGTCTCTG -3'

Sequencing Primer
(F):5'- AACAGCAGCTTTGAGGTCTACTG -3'
(R):5'- AAACCTCAGGTCATGGTTGTAG -3'
Posted On2016-07-06