Incidental Mutation 'R5250:Zfp568'
ID398940
Institutional Source Beutler Lab
Gene Symbol Zfp568
Ensembl Gene ENSMUSG00000074221
Gene Namezinc finger protein 568
Synonymschato, LOC381866
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29983955-30028282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30017230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000118387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074322] [ENSMUST00000146074] [ENSMUST00000148442] [ENSMUST00000177931] [ENSMUST00000207940]
Predicted Effect probably benign
Transcript: ENSMUST00000074322
AA Change: V185A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073930
Gene: ENSMUSG00000074221
AA Change: V185A

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146074
AA Change: V184A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118823
Gene: ENSMUSG00000074221
AA Change: V184A

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148442
AA Change: V185A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118387
Gene: ENSMUSG00000074221
AA Change: V185A

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177931
AA Change: V184A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137438
Gene: ENSMUSG00000074221
AA Change: V184A

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207940
Meta Mutation Damage Score 0.1087 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous null mutants are embryonic lethal with growth arrest around E8.5-9.0. Mutant embryo shows shortened anterior-posterior axial extension with defects in somites and midline structures including open gut tube, cardia bifida, and failure to closeneural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Other mutations in Zfp568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zfp568 APN 7 30022440 missense possibly damaging 0.66
IGL00792:Zfp568 APN 7 30015072 missense probably benign 0.00
IGL01133:Zfp568 APN 7 29987808 critical splice donor site probably null
IGL01330:Zfp568 APN 7 30022277 missense probably benign 0.01
IGL03157:Zfp568 APN 7 30022764 missense probably damaging 1.00
R0739:Zfp568 UTSW 7 30023321 missense probably damaging 1.00
R1051:Zfp568 UTSW 7 30022529 nonsense probably null
R1967:Zfp568 UTSW 7 29989088 missense probably damaging 0.99
R2038:Zfp568 UTSW 7 29989082 missense probably null 1.00
R3874:Zfp568 UTSW 7 30023396 missense probably damaging 1.00
R4438:Zfp568 UTSW 7 30022296 missense probably benign
R4584:Zfp568 UTSW 7 29998192 missense probably benign 0.04
R4667:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4669:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4773:Zfp568 UTSW 7 29997770 missense probably damaging 1.00
R4791:Zfp568 UTSW 7 30015183 missense probably damaging 1.00
R5541:Zfp568 UTSW 7 30022876 missense possibly damaging 0.81
R5956:Zfp568 UTSW 7 29997863 missense probably damaging 1.00
R6444:Zfp568 UTSW 7 30017257 missense probably benign 0.01
R6600:Zfp568 UTSW 7 30022523 missense possibly damaging 0.71
R7299:Zfp568 UTSW 7 30017244 missense probably benign 0.34
R7316:Zfp568 UTSW 7 30022256 missense possibly damaging 0.95
R7562:Zfp568 UTSW 7 30023256 missense probably benign 0.04
R7664:Zfp568 UTSW 7 30022290 missense probably benign
R7672:Zfp568 UTSW 7 29997787 missense probably damaging 0.99
R7759:Zfp568 UTSW 7 30023414 missense possibly damaging 0.66
R7790:Zfp568 UTSW 7 30022725 missense probably damaging 1.00
R7811:Zfp568 UTSW 7 29997870 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCCCTGGAATAATACATGGGG -3'
(R):5'- TTGTGCTAAGACGCCCTTC -3'

Sequencing Primer
(F):5'- GACAAAGTCCTTTTATGTGATGGCAG -3'
(R):5'- CCCCCAGACCTCAGGCTTTG -3'
Posted On2016-07-06