Mutagenetix > Incidental Mutation

Incidental Mutation 'R5173:Mylk'

398943

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210

MMRRC Submission

042753-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5173 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34565580-34822790 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34797383 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1614 (H1614R)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023538
AA Change: H1614R

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: H1614R

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232482

Meta Mutation Damage Score

0.9436

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	AC	A	11: 9,632,032 (GRCm39)		probably null	Het
Abca6	A	T	11: 110,082,546 (GRCm39)	F1142L	probably benign	Het
Ap1g1	T	A	8: 110,577,764 (GRCm39)		probably null	Het
Apob	T	C	12: 8,058,238 (GRCm39)	V2207A	probably benign	Het
Cenpp	CAAACCTGAAAA	CAAA	13: 49,618,258 (GRCm39)		probably null	Het
Chd3	A	G	11: 69,260,069 (GRCm39)		probably benign	Het
Coch	C	A	12: 51,643,290 (GRCm39)	Y103*	probably null	Het
Cul3	A	T	1: 80,259,133 (GRCm39)	D382E	possibly damaging	Het
Cul5	T	C	9: 53,554,034 (GRCm39)	T291A	probably benign	Het
Dab1	T	C	4: 104,545,645 (GRCm39)		probably null	Het
Dmtf1	A	G	5: 9,190,356 (GRCm39)		probably benign	Het
Dpp4	T	C	2: 62,217,474 (GRCm39)	Y41C	probably damaging	Het
Eif2ak4	A	G	2: 118,238,841 (GRCm39)	I45M	probably damaging	Het
Epn3	T	C	11: 94,386,923 (GRCm39)	K149R	probably damaging	Het
Flnc	A	G	6: 29,455,537 (GRCm39)	E2029G	probably damaging	Het
Gm5799	A	G	14: 43,782,116 (GRCm39)	N96S	probably damaging	Het
Gprc5c	G	T	11: 114,755,093 (GRCm39)	V257L	possibly damaging	Het
Grik5	T	C	7: 24,762,319 (GRCm39)	H224R	possibly damaging	Het
Lpar6	A	T	14: 73,476,537 (GRCm39)	E166V	probably benign	Het
Mical1	T	C	10: 41,360,985 (GRCm39)	L683P	probably damaging	Het
Mis18bp1	T	C	12: 65,196,149 (GRCm39)	I538M	possibly damaging	Het
Mobp	A	G	9: 119,997,311 (GRCm39)	R77G	possibly damaging	Het
Muc21	G	T	17: 35,931,633 (GRCm39)		probably benign	Het
Or2y16	T	C	11: 49,334,713 (GRCm39)	F12L	probably benign	Het
Or4p18	G	A	2: 88,233,266 (GRCm39)	T4I	probably benign	Het
Or7c19	T	C	8: 85,957,205 (GRCm39)	L27P	probably damaging	Het
Osbpl1a	C	T	18: 12,895,697 (GRCm39)	V390I	probably benign	Het
Pcdha7	C	A	18: 37,107,705 (GRCm39)	D243E	probably benign	Het
Pi4ka	A	T	16: 17,168,770 (GRCm39)	N653K	possibly damaging	Het
Plin5	T	G	17: 56,422,548 (GRCm39)		probably null	Het
Plod1	A	G	4: 148,000,758 (GRCm39)		probably benign	Het
Psd3	T	C	8: 68,149,641 (GRCm39)	K372E	probably damaging	Het
Psmd11	C	T	11: 80,351,566 (GRCm39)	T263I	probably benign	Het
Ptprt	A	T	2: 161,769,676 (GRCm39)	N396K	probably benign	Het
Rab39	T	C	9: 53,597,800 (GRCm39)	E155G	probably damaging	Het
Rimbp2	T	C	5: 128,874,712 (GRCm39)	D293G	probably benign	Het
Rnf220	T	C	4: 117,146,471 (GRCm39)		probably benign	Het
Rnmt	C	T	18: 68,454,430 (GRCm39)		probably benign	Het
Slc10a1	T	A	12: 81,002,802 (GRCm39)	I279F	probably damaging	Het
Sp140l1	G	A	1: 85,078,288 (GRCm39)	R54*	probably null	Het
Taar6	A	G	10: 23,861,250 (GRCm39)	Y99H	probably damaging	Het
Tas2r144	T	A	6: 42,193,048 (GRCm39)	F263I	probably benign	Het
Tex15	T	A	8: 34,061,768 (GRCm39)	N399K	possibly damaging	Het
Tlr9	T	A	9: 106,103,151 (GRCm39)	V814D	possibly damaging	Het
Tmem53	T	A	4: 117,122,908 (GRCm39)		probably benign	Het
Ubap2l	T	C	3: 89,928,337 (GRCm39)	I511V	possibly damaging	Het
Vmn2r60	T	C	7: 41,844,935 (GRCm39)	M766T	probably damaging	Het
Zfp462	T	C	4: 55,011,115 (GRCm39)	V1027A	probably damaging	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34,759,322 (GRCm39)	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34,791,610 (GRCm39)	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34,792,310 (GRCm39)	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34,809,247 (GRCm39)	splice site	probably benign
IGL02079:Mylk	APN	16	34,681,001 (GRCm39)	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34,635,805 (GRCm39)	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34,750,266 (GRCm39)	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34,784,016 (GRCm39)	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34,806,911 (GRCm39)	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34,735,270 (GRCm39)	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34,742,158 (GRCm39)	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34,773,151 (GRCm39)	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34,732,562 (GRCm39)	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34,799,559 (GRCm39)	missense	probably benign	0.09
billy	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
brutus	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
Club	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
popeye	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34,797,483 (GRCm39)	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34,696,012 (GRCm39)	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34,695,874 (GRCm39)	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34,732,667 (GRCm39)	splice site	probably benign
R0358:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34,605,344 (GRCm39)	splice site	probably null
R0390:Mylk	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.01
R0536:Mylk	UTSW	16	34,820,757 (GRCm39)	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	34,820,799 (GRCm39)	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34,694,409 (GRCm39)	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34,681,022 (GRCm39)	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34,635,835 (GRCm39)	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34,695,956 (GRCm39)	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34,696,005 (GRCm39)	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34,773,152 (GRCm39)	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34,700,673 (GRCm39)	splice site	probably null
R2016:Mylk	UTSW	16	34,817,187 (GRCm39)	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34,774,023 (GRCm39)	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34,806,846 (GRCm39)	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34,700,538 (GRCm39)	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34,742,247 (GRCm39)	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
R4470:Mylk	UTSW	16	34,732,522 (GRCm39)	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34,742,805 (GRCm39)	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34,699,539 (GRCm39)	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34,715,295 (GRCm39)	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34,742,737 (GRCm39)	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34,735,360 (GRCm39)	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34,809,331 (GRCm39)	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34,791,810 (GRCm39)	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34,719,877 (GRCm39)	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34,809,367 (GRCm39)	missense	probably damaging	1.00
R5195:Mylk	UTSW	16	34,799,585 (GRCm39)	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34,742,995 (GRCm39)	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34,742,127 (GRCm39)	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34,741,974 (GRCm39)	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34,699,722 (GRCm39)	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34,776,862 (GRCm39)	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34,715,317 (GRCm39)	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34,715,213 (GRCm39)	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34,742,341 (GRCm39)	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34,680,961 (GRCm39)	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34,750,237 (GRCm39)	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34,750,258 (GRCm39)	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34,694,520 (GRCm39)	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34,700,643 (GRCm39)	missense	probably benign	0.18
R6949:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	34,820,796 (GRCm39)	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34,797,352 (GRCm39)	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34,605,381 (GRCm39)	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34,734,446 (GRCm39)	splice site	probably null
R7525:Mylk	UTSW	16	34,809,357 (GRCm39)	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34,742,887 (GRCm39)	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34,715,184 (GRCm39)	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34,699,927 (GRCm39)	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34,742,553 (GRCm39)	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34,784,018 (GRCm39)	nonsense	probably null
R7892:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34,734,525 (GRCm39)	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	34,820,721 (GRCm39)	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34,742,949 (GRCm39)	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34,750,257 (GRCm39)	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34,817,176 (GRCm39)	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34,741,427 (GRCm39)	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34,719,772 (GRCm39)	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34,791,779 (GRCm39)	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34,776,835 (GRCm39)	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34,696,012 (GRCm39)	nonsense	probably null
R9624:Mylk	UTSW	16	34,699,677 (GRCm39)	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34,735,179 (GRCm39)	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34,734,387 (GRCm39)	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34,699,482 (GRCm39)	nonsense	probably null
RF001:Mylk	UTSW	16	34,699,741 (GRCm39)	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
X0065:Mylk	UTSW	16	34,820,811 (GRCm39)	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34,743,021 (GRCm39)	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AGCGTCCTATTGTGTGACTG -3'
(R):5'- GCTGGATTTGAACCTGAGAAGTC -3'

Sequencing Primer
(F):5'- CCTATTGTGTGACTGCAGTGC -3'
(R):5'- GAACCTGAGAAGTCTTACTGGTC -3'

Posted On

2016-07-06