Incidental Mutation 'R5250:Adora2a'
ID398957
Institutional Source Beutler Lab
Gene Symbol Adora2a
Ensembl Gene ENSMUSG00000020178
Gene Nameadenosine A2a receptor
SynonymsA2AAR, AA2AR, A2aR, A2a, Rs
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75316877-75334784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75326048 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 7 (I7T)
Ref Sequence ENSEMBL: ENSMUSP00000101060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105420] [ENSMUST00000217703] [ENSMUST00000219044] [ENSMUST00000219322]
Predicted Effect probably damaging
Transcript: ENSMUST00000105420
AA Change: I7T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101060
Gene: ENSMUSG00000020178
AA Change: I7T

DomainStartEndE-ValueType
Pfam:7tm_4 11 301 1.9e-9 PFAM
Pfam:7TM_GPCR_Srsx 14 298 5.1e-15 PFAM
Pfam:7tm_1 20 283 3.1e-62 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217703
Predicted Effect possibly damaging
Transcript: ENSMUST00000219044
AA Change: I7T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000219322
AA Change: I7T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.5408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable and fertile with reduced exploratory activity and displaying depressive rather than stimulatory response to caffeine. Mutants test more anxious, were more aggressive towards intruders, and slower to respond to pain stimuli. Blood pressure and heart rate are increased, as well as platelet aggregation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Adora2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adora2a APN 10 75333451 missense probably damaging 0.99
IGL01298:Adora2a APN 10 75333492 missense probably damaging 1.00
R1217:Adora2a UTSW 10 75333215 missense probably damaging 1.00
R1983:Adora2a UTSW 10 75333646 missense probably benign 0.04
R2329:Adora2a UTSW 10 75326183 missense probably damaging 1.00
R4808:Adora2a UTSW 10 75333446 missense probably damaging 1.00
R4884:Adora2a UTSW 10 75326045 missense probably null 0.99
R5056:Adora2a UTSW 10 75326158 missense probably damaging 1.00
R6153:Adora2a UTSW 10 75326147 missense possibly damaging 0.78
R6306:Adora2a UTSW 10 75333404 missense probably damaging 1.00
R6746:Adora2a UTSW 10 75333608 missense probably benign 0.12
R7047:Adora2a UTSW 10 75326311 missense probably damaging 1.00
R7493:Adora2a UTSW 10 75333589 missense possibly damaging 0.92
R7792:Adora2a UTSW 10 75333646 missense probably benign 0.00
RF004:Adora2a UTSW 10 75333154 missense probably benign 0.00
X0017:Adora2a UTSW 10 75333563 missense probably damaging 1.00
Z1176:Adora2a UTSW 10 75333328 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTTGGGAAGCTCTC -3'
(R):5'- TGAAGATGGAACTCTGCGTG -3'

Sequencing Primer
(F):5'- AAGCTCTCCCTGGGAACG -3'
(R):5'- ATGGAACTCTGCGTGAGGACC -3'
Posted On2016-07-06