Incidental Mutation 'R5250:Ppp1r13b'
ID398977
Institutional Source Beutler Lab
Gene Symbol Ppp1r13b
Ensembl Gene ENSMUSG00000021285
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13B
SynonymsASPP1
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111828457-111908110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111844960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 165 (R165S)
Ref Sequence ENSEMBL: ENSMUSP00000062464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054815] [ENSMUST00000220486]
Predicted Effect probably benign
Transcript: ENSMUST00000054815
AA Change: R165S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062464
Gene: ENSMUSG00000021285
AA Change: R165S

DomainStartEndE-ValueType
PDB:2UWQ|A 1 83 8e-35 PDB
Blast:RA 5 84 3e-47 BLAST
coiled coil region 123 305 N/A INTRINSIC
low complexity region 437 476 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
PDB:4IRV|H 695 741 1e-12 PDB
ANK 917 946 4.16e-7 SMART
ANK 950 979 4.63e-5 SMART
SH3 1019 1077 1.79e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220486
AA Change: R7S
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants show lymphatic vascular phenotypes with subcutaneous edema detected only during embryogenesis, delayed lymphatic vessel formation, and mispatterned collecting lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Ppp1r13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ppp1r13b APN 12 111829370 missense probably damaging 0.99
IGL01102:Ppp1r13b APN 12 111833219 missense probably benign
IGL01621:Ppp1r13b APN 12 111835092 missense possibly damaging 0.50
IGL01677:Ppp1r13b APN 12 111843665 missense probably benign 0.18
IGL01720:Ppp1r13b APN 12 111858260 missense probably benign 0.05
IGL01921:Ppp1r13b APN 12 111833237 missense probably benign
IGL02059:Ppp1r13b APN 12 111833347 missense probably damaging 1.00
IGL02187:Ppp1r13b APN 12 111835038 missense probably damaging 0.99
IGL02262:Ppp1r13b APN 12 111835211 missense possibly damaging 0.88
IGL02385:Ppp1r13b APN 12 111835043 missense probably damaging 1.00
IGL02894:Ppp1r13b APN 12 111831454 unclassified probably benign
IGL03027:Ppp1r13b APN 12 111830396 nonsense probably null
IGL03049:Ppp1r13b APN 12 111833229 missense probably benign 0.29
PIT4468001:Ppp1r13b UTSW 12 111838702 missense probably benign 0.08
PIT4472001:Ppp1r13b UTSW 12 111832640 missense probably damaging 1.00
R0393:Ppp1r13b UTSW 12 111835688 missense probably benign 0.01
R0561:Ppp1r13b UTSW 12 111866446 missense probably damaging 1.00
R1067:Ppp1r13b UTSW 12 111835116 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1512:Ppp1r13b UTSW 12 111872408 missense possibly damaging 0.84
R1563:Ppp1r13b UTSW 12 111840982 missense probably damaging 1.00
R1918:Ppp1r13b UTSW 12 111834810 missense probably damaging 1.00
R2014:Ppp1r13b UTSW 12 111833788 missense probably benign
R2134:Ppp1r13b UTSW 12 111833733 missense probably benign 0.00
R2306:Ppp1r13b UTSW 12 111844893 missense probably damaging 1.00
R3508:Ppp1r13b UTSW 12 111872367 missense probably damaging 1.00
R3767:Ppp1r13b UTSW 12 111846417 missense probably damaging 0.99
R4237:Ppp1r13b UTSW 12 111838736 missense probably benign
R4278:Ppp1r13b UTSW 12 111830384 missense probably damaging 0.96
R4690:Ppp1r13b UTSW 12 111832558 missense probably damaging 1.00
R4702:Ppp1r13b UTSW 12 111833281 missense probably benign 0.00
R5094:Ppp1r13b UTSW 12 111843610 missense probably benign 0.00
R5444:Ppp1r13b UTSW 12 111838688 missense probably benign
R5607:Ppp1r13b UTSW 12 111833789 missense probably benign 0.44
R5874:Ppp1r13b UTSW 12 111844989 missense probably damaging 1.00
R5935:Ppp1r13b UTSW 12 111830442 missense probably benign
R6074:Ppp1r13b UTSW 12 111832402 missense probably damaging 1.00
R6253:Ppp1r13b UTSW 12 111835726 missense probably benign
R6511:Ppp1r13b UTSW 12 111831567 missense probably damaging 1.00
R6836:Ppp1r13b UTSW 12 111835195 missense probably benign 0.16
R6968:Ppp1r13b UTSW 12 111833178 missense possibly damaging 0.76
R7269:Ppp1r13b UTSW 12 111834919 missense probably damaging 0.99
R7284:Ppp1r13b UTSW 12 111834966 missense possibly damaging 0.82
R7304:Ppp1r13b UTSW 12 111872406 missense possibly damaging 0.49
R7314:Ppp1r13b UTSW 12 111846356 missense probably damaging 1.00
R7393:Ppp1r13b UTSW 12 111838754 missense probably damaging 1.00
R7639:Ppp1r13b UTSW 12 111833615 missense probably damaging 1.00
R7873:Ppp1r13b UTSW 12 111834886 missense probably damaging 1.00
R7956:Ppp1r13b UTSW 12 111834886 missense probably damaging 1.00
X0010:Ppp1r13b UTSW 12 111831459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAAACGTGCAGTGCCATTTG -3'
(R):5'- TGGTCTGACGTGTGCAGAATTC -3'

Sequencing Primer
(F):5'- CAGTGCCATTTGGGATTGTGACC -3'
(R):5'- ACGTGTGCAGAATTCCTTCAG -3'
Posted On2016-07-06