Mutagenetix > Incidental Mutation

Incidental Mutation 'R5174:Cadps2'

398984

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

042754-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5174 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23287743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 1181 (Y1181F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: Y1186F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: Y1186F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000069074
AA Change: Y1179F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: Y1179F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115357
AA Change: Y1181F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111014
Gene: ENSMUSG00000017978
AA Change: Y1181F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	806	897	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115358
AA Change: Y1146F

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: Y1146F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115361
AA Change: Y1141F

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: Y1141F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125350
AA Change: Y781F

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: Y781F

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142913
AA Change: Y1157F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: Y1157F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152131

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156986

Predicted Effect

probably damaging
Transcript: ENSMUST00000163871
AA Change: Y1186F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: Y1186F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166458
AA Change: Y1157F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: Y1157F

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.4645

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	C	T	9: 103,282,556		probably null	Het
Ank3	T	C	10: 69,892,379	S632P	probably damaging	Het
Arhgef16	G	A	4: 154,282,047	R451W	probably damaging	Het
Asxl3	A	T	18: 22,523,115	D1394V	probably benign	Het
Atp2a3	T	A	11: 72,980,215	I545N	probably damaging	Het
Camkmt	C	A	17: 85,452,237	F268L	probably benign	Het
Casp14	C	T	10: 78,715,391	G20D	possibly damaging	Het
Celf1	T	C	2: 91,001,008	C61R	probably damaging	Het
Cenpp	CAAACCTGAAAA	CAAA	13: 49,464,782		probably null	Het
Cers3	A	T	7: 66,784,868	K203M	probably damaging	Het
Clip4	T	C	17: 71,810,962	F334S	probably damaging	Het
Cyp2b13	T	A	7: 26,088,693	D415E	possibly damaging	Het
Decr2	A	T	17: 26,087,469		probably null	Het
Dmxl2	T	C	9: 54,445,484		probably null	Het
Dnah7b	G	A	1: 46,243,349	A2881T	possibly damaging	Het
Dnaja3	A	G	16: 4,684,297	H55R	probably benign	Het
Dnajc11	T	C	4: 151,979,984	F531L	probably damaging	Het
Efcab6	A	G	15: 84,054,486	F10L	probably benign	Het
Epm2aip1	T	C	9: 111,273,387	F476S	probably damaging	Het
Fat3	T	C	9: 15,999,570	N1712S	probably damaging	Het
Flnc	T	C	6: 29,448,894	V1343A	possibly damaging	Het
Fsip2	C	T	2: 82,980,741	P2468L	probably benign	Het
Gm5798	A	G	14: 41,348,663	H10R	possibly damaging	Het
Gm7168	A	G	17: 13,948,455	Y28C	probably damaging	Het
Gm9866	A	T	12: 27,142,028		noncoding transcript	Het
Gtpbp6	G	A	5: 110,108,117	R19C	possibly damaging	Het
Gucy2e	A	G	11: 69,236,566	F27S	probably benign	Het
Krba1	A	G	6: 48,412,295	E548G	probably damaging	Het
Ltbr	A	G	6: 125,309,537	S229P	probably benign	Het
Mgat5b	A	T	11: 116,977,715	Y488F	probably benign	Het
Mia3	T	A	1: 183,331,493	K475*	probably null	Het
Mrpl53	C	T	6: 83,109,657	T114M	possibly damaging	Het
Mrps35	T	C	6: 147,060,211	Y195H	possibly damaging	Het
Muc4	A	T	16: 32,751,738	I539F	possibly damaging	Het
Nedd1	T	A	10: 92,711,212	T150S	possibly damaging	Het
Nox4	T	G	7: 87,323,766	I327S	probably benign	Het
Nrk	C	G	X: 138,986,779	A1018G	probably benign	Het
Olfr1152	T	A	2: 87,868,411	V140E	possibly damaging	Het
Olfr1189	T	A	2: 88,592,648	N281K	probably damaging	Het
Olfr608	T	A	7: 103,470,403	F121L	probably benign	Het
Olfr984	T	C	9: 40,100,747	T248A	possibly damaging	Het
Pdzd2	G	A	15: 12,372,514	P2512S	probably benign	Het
Ptgis	T	A	2: 167,203,470		probably null	Het
Rnf170	T	A	8: 26,129,168	M140K	probably benign	Het
Scaf4	A	T	16: 90,247,174	I637K	unknown	Het
Sdccag8	A	T	1: 176,845,350	T270S	probably damaging	Het
Sec24d	T	C	3: 123,364,926	C1022R	probably damaging	Het
Sec63	T	C	10: 42,829,081		probably benign	Het
Serpinb3d	C	G	1: 107,078,498	E287Q	possibly damaging	Het
Smarcd2	A	G	11: 106,267,045		probably benign	Het
Sox15	A	G	11: 69,655,719	Y116C	probably damaging	Het
Spag16	T	C	1: 70,493,796	S545P	probably damaging	Het
Ssc5d	C	A	7: 4,927,971	T184N	possibly damaging	Het
St6galnac2	A	T	11: 116,681,947	F228I	probably damaging	Het
Syne1	T	C	10: 5,041,490	N8408S	probably damaging	Het
Trank1	A	C	9: 111,365,559	T884P	probably benign	Het
Ubr3	T	A	2: 70,009,162	L1540H	probably damaging	Het
Ugt2b37	C	A	5: 87,251,880	M256I	probably benign	Het
Vmn2r69	G	A	7: 85,415,531	T49I	possibly damaging	Het
Vmn2r72	T	A	7: 85,737,840	I839L	probably benign	Het
Zcrb1	A	G	15: 93,387,575		probably null	Het
Zfp319	A	T	8: 95,328,169		probably null	Het
Zfp592	T	C	7: 81,038,325	S1000P	probably damaging	Het
Zfp938	T	C	10: 82,226,004	N261D	possibly damaging	Het
Zfp957	A	G	14: 79,213,388	S324P	unknown	Het
Zswim6	G	T	13: 107,726,681		noncoding transcript	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTAGTTGTTATGCCTAAATGAAG -3'
(R):5'- ACACGCACTAGGCATTATTGAC -3'

Sequencing Primer
(F):5'- GCCTAAATGAAGACCTTAGTACTAAC -3'
(R):5'- CGCACTAGGCATTATTGACTTGATC -3'

Posted On

2016-07-06