Incidental Mutation 'R5250:Atg14'
ID398985
Institutional Source Beutler Lab
Gene Symbol Atg14
Ensembl Gene ENSMUSG00000037526
Gene Nameautophagy related 14
SynonymsBarkor, D14Ertd436e, D14Ertd114e
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location47540893-47570649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47568199 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 70 (R70C)
Ref Sequence ENSEMBL: ENSMUSP00000153718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042988] [ENSMUST00000226299]
Predicted Effect probably damaging
Transcript: ENSMUST00000042988
AA Change: R70C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039047
Gene: ENSMUSG00000037526
AA Change: R70C

DomainStartEndE-ValueType
Pfam:Atg14 43 393 1.1e-79 PFAM
low complexity region 447 464 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226299
AA Change: R70C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000228784
AA Change: R69C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228790
Meta Mutation Damage Score 0.2264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele following delivery of a Tat-cre exhibit increased mucin accumulation in colonic epithelial spheroids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Atg14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Atg14 APN 14 47542859 missense probably benign 0.00
IGL02513:Atg14 APN 14 47548994 missense probably benign 0.03
IGL02513:Atg14 APN 14 47545624 splice site probably benign
PIT4243001:Atg14 UTSW 14 47554574 missense possibly damaging 0.77
R1463:Atg14 UTSW 14 47548994 missense probably benign 0.03
R1479:Atg14 UTSW 14 47547239 critical splice donor site probably null
R1499:Atg14 UTSW 14 47560645 missense probably benign
R1781:Atg14 UTSW 14 47549150 critical splice acceptor site probably null
R1974:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R2089:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2113:Atg14 UTSW 14 47551324 missense probably damaging 1.00
R4231:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4232:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4233:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4234:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4236:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4360:Atg14 UTSW 14 47568370 missense probably benign 0.00
R4711:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R4883:Atg14 UTSW 14 47551314 missense probably damaging 1.00
R5025:Atg14 UTSW 14 47545816 missense probably damaging 1.00
R5235:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5297:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5301:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5338:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5450:Atg14 UTSW 14 47551464 missense probably benign
R5475:Atg14 UTSW 14 47568336 missense possibly damaging 0.83
R5799:Atg14 UTSW 14 47547295 missense possibly damaging 0.63
R6489:Atg14 UTSW 14 47549023 missense probably damaging 0.97
R7589:Atg14 UTSW 14 47543090 missense probably benign 0.00
R7908:Atg14 UTSW 14 47568593 unclassified probably benign
Z1088:Atg14 UTSW 14 47568292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACCTACGTTCACCTAGC -3'
(R):5'- ATCATCATGGCGTCTCCCAG -3'

Sequencing Primer
(F):5'- TACGTTCACCTAGCACCCAC -3'
(R):5'- AAGGGATCTTGGACGCCC -3'
Posted On2016-07-06