Incidental Mutation 'R5174:Flnc'
ID398986
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Namefilamin C, gamma
Synonyms1110055E19Rik, actin binding protein 280, Fln2
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29433256-29461883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29448894 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1343 (V1343A)
Ref Sequence ENSEMBL: ENSMUSP00000099139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065090
AA Change: V1343A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: V1343A

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101617
AA Change: V1343A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: V1343A

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Meta Mutation Damage Score 0.3580 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0748:Flnc UTSW 6 29446344 missense probably damaging 0.99
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2016:Flnc UTSW 6 29443797 critical splice donor site probably null
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6717:Flnc UTSW 6 29450902 small deletion probably benign
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
R7413:Flnc UTSW 6 29452259 missense probably damaging 1.00
R7422:Flnc UTSW 6 29455471 missense probably damaging 1.00
R7559:Flnc UTSW 6 29459010 missense probably damaging 1.00
R7632:Flnc UTSW 6 29446985 missense probably damaging 0.98
R7651:Flnc UTSW 6 29444050 missense probably benign 0.08
R7679:Flnc UTSW 6 29456790 missense probably benign 0.00
R7697:Flnc UTSW 6 29456517 missense probably damaging 0.98
R7788:Flnc UTSW 6 29456444 missense possibly damaging 0.67
R7852:Flnc UTSW 6 29440898 missense probably damaging 1.00
R7870:Flnc UTSW 6 29454307 missense probably damaging 1.00
R7873:Flnc UTSW 6 29456991 missense possibly damaging 0.88
R7921:Flnc UTSW 6 29447770 missense possibly damaging 0.58
R7950:Flnc UTSW 6 29456382 missense possibly damaging 0.61
R7953:Flnc UTSW 6 29447829 missense probably damaging 0.99
R7970:Flnc UTSW 6 29447526 missense possibly damaging 0.96
R8071:Flnc UTSW 6 29457446 missense probably damaging 1.00
R8143:Flnc UTSW 6 29441485 missense probably benign 0.20
R8166:Flnc UTSW 6 29433732 missense probably damaging 0.99
R8167:Flnc UTSW 6 29455922 missense probably damaging 0.98
R8306:Flnc UTSW 6 29449370 missense probably benign 0.05
R8428:Flnc UTSW 6 29450850 missense probably benign 0.36
R8466:Flnc UTSW 6 29438622 missense probably damaging 0.98
R8671:Flnc UTSW 6 29443502 critical splice donor site probably null
R8885:Flnc UTSW 6 29455411 missense probably damaging 0.96
R8922:Flnc UTSW 6 29456836 missense probably damaging 0.99
R8923:Flnc UTSW 6 29452237 missense probably damaging 1.00
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Z1177:Flnc UTSW 6 29447545 missense probably damaging 1.00
Z1177:Flnc UTSW 6 29457130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGTGACAGACAACGGG -3'
(R):5'- CTCTGACAGATGGGAAGGAC -3'

Sequencing Primer
(F):5'- CAGTACACTGCCTATGAAGAGG -3'
(R):5'- CAAACAAGCAGAGATCAAGATGGAC -3'
Posted On2016-07-06