Incidental Mutation 'R5174:Ltbr'
ID398992
Institutional Source Beutler Lab
Gene Symbol Ltbr
Ensembl Gene ENSMUSG00000030339
Gene Namelymphotoxin B receptor
SynonymsTNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5174 (G1)
Quality Score196
Status Validated
Chromosome6
Chromosomal Location125306571-125313885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125309537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000032489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032489]
Predicted Effect probably benign
Transcript: ENSMUST00000032489
AA Change: S229P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: S229P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161891
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Ltbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
bonsai UTSW 6 125312770 missense probably damaging 1.00
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
moksha UTSW 6 125308068 missense probably benign 0.00
Questionable UTSW 6 125313375 splice site probably benign
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2199:Ltbr UTSW 6 125312061 missense probably benign 0.25
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5268:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5361:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5434:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6217:Ltbr UTSW 6 125307454 missense probably damaging 1.00
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
R7101:Ltbr UTSW 6 125312800 missense probably benign 0.00
R7584:Ltbr UTSW 6 125307241 missense probably benign 0.09
R7587:Ltbr UTSW 6 125312352 missense probably benign
R8798:Ltbr UTSW 6 125307295 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGGAGGATGATAGAGTTACCC -3'
(R):5'- TCAGGACAGAGTCTCTCGTGTG -3'

Sequencing Primer
(F):5'- GAGGATGATAGAGTTACCCTTAACCC -3'
(R):5'- AGAGTCTCTCGTGTGGTCAAAAGATC -3'
Posted On2016-07-06