Incidental Mutation 'R5250:Ubr2'
ID398993
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Nameubiquitin protein ligase E3 component n-recognin 2
Synonyms9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46928295-47010556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46930442 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1729 (Q1729K)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]
Predicted Effect probably benign
Transcript: ENSMUST00000113335
AA Change: Q1729K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: Q1729K

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113337
AA Change: Q1729K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: Q1729K

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 intron probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7952:Ubr2 UTSW 17 46991008 missense probably benign 0.00
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGATTCAGCCGAACTTATTTCCTG -3'
(R):5'- TCTAACTGTGTGGCACTGGAG -3'

Sequencing Primer
(F):5'- CTGTTGTCTTTCTGGAAAAGCC -3'
(R):5'- TGTGGCACTGGAGTACCTAC -3'
Posted On2016-07-06