Incidental Mutation 'R5250:Myot'
ID398998
Institutional Source Beutler Lab
Gene Symbol Myot
Ensembl Gene ENSMUSG00000024471
Gene Namemyotilin
SynonymsTtid, 5530402I04Rik
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44334074-44355724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44346070 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 291 (D291E)
Ref Sequence ENSEMBL: ENSMUSP00000111160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025349] [ENSMUST00000115498]
Predicted Effect probably damaging
Transcript: ENSMUST00000025349
AA Change: D291E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025349
Gene: ENSMUSG00000024471
AA Change: D291E

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
IG 254 339 5.84e-5 SMART
IGc2 359 428 5.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115498
AA Change: D291E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111160
Gene: ENSMUSG00000024471
AA Change: D291E

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
IG 254 339 5.84e-5 SMART
IGc2 359 428 5.53e-6 SMART
Meta Mutation Damage Score 0.4148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cystoskeletal protein which plays a significant role in the stability of thin filaments during muscle contraction. This protein binds F-actin, crosslinks actin filaments, and prevents latrunculin A-induced filament disassembly. Mutations in this gene have been associated with limb-girdle muscular dystrophy and myofibrillar myopathies. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with normal skeletal and cardiac muscle morphology and function, growth rate, survival, and internal organ morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Myot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Myot APN 18 44337114 missense possibly damaging 0.85
IGL02117:Myot APN 18 44355110 missense probably benign 0.36
IGL02812:Myot APN 18 44346060 missense probably damaging 1.00
R0178:Myot UTSW 18 44336986 missense probably damaging 1.00
R1512:Myot UTSW 18 44342355 missense probably damaging 1.00
R1620:Myot UTSW 18 44337058 missense possibly damaging 0.48
R2140:Myot UTSW 18 44354125 missense possibly damaging 0.53
R2234:Myot UTSW 18 44354272 missense probably damaging 0.98
R2235:Myot UTSW 18 44354272 missense probably damaging 0.98
R2568:Myot UTSW 18 44337216 missense probably benign 0.02
R3702:Myot UTSW 18 44354095 intron probably null
R4967:Myot UTSW 18 44354928 missense possibly damaging 0.68
R5154:Myot UTSW 18 44354214 missense probably benign
R5322:Myot UTSW 18 44354149 missense probably benign 0.05
R7110:Myot UTSW 18 44341386 missense probably damaging 1.00
R7385:Myot UTSW 18 44337008 nonsense probably null
R7529:Myot UTSW 18 44346173 nonsense probably null
R7899:Myot UTSW 18 44354184 missense probably benign 0.01
R7982:Myot UTSW 18 44354184 missense probably benign 0.01
R8006:Myot UTSW 18 44354837 missense probably damaging 1.00
Z1176:Myot UTSW 18 44346085 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGAACCTGAGGTTGTGTTTG -3'
(R):5'- GAAGTGTCTCTGGGCTTTCC -3'

Sequencing Primer
(F):5'- ACCTGAGGTTGTGTTTGAAAGAAATG -3'
(R):5'- AGCCAGGCTGCCTTTGAAG -3'
Posted On2016-07-06