Incidental Mutation 'R5250:Rasgrp2'
ID399000
Institutional Source Beutler Lab
Gene Symbol Rasgrp2
Ensembl Gene ENSMUSG00000032946
Gene NameRAS, guanyl releasing protein 2
SynonymsCaldaggef1, CalDAG-GEFI
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6399340-6415216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6404313 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 129 (W129R)
Ref Sequence ENSEMBL: ENSMUSP00000129873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035716] [ENSMUST00000113467] [ENSMUST00000113468] [ENSMUST00000113469] [ENSMUST00000113471] [ENSMUST00000113472] [ENSMUST00000113475] [ENSMUST00000113476] [ENSMUST00000127021] [ENSMUST00000138555] [ENSMUST00000139522] [ENSMUST00000146601] [ENSMUST00000146831] [ENSMUST00000150713] [ENSMUST00000167240]
Predicted Effect probably damaging
Transcript: ENSMUST00000035716
AA Change: W129R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946
AA Change: W129R

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113467
SMART Domains Protein: ENSMUSP00000109095
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113468
SMART Domains Protein: ENSMUSP00000109096
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 97 1.93e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113469
SMART Domains Protein: ENSMUSP00000109097
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113471
SMART Domains Protein: ENSMUSP00000109099
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113472
SMART Domains Protein: ENSMUSP00000109100
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113475
SMART Domains Protein: ENSMUSP00000109103
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113476
AA Change: W129R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946
AA Change: W129R

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123661
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135532
Predicted Effect probably damaging
Transcript: ENSMUST00000138555
AA Change: W129R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946
AA Change: W129R

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145611
Predicted Effect probably benign
Transcript: ENSMUST00000146601
SMART Domains Protein: ENSMUSP00000117681
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 58 1e-35 BLAST
SCOP:d1bkds_ 9 58 1e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146831
AA Change: W129R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946
AA Change: W129R

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149205
Predicted Effect probably benign
Transcript: ENSMUST00000150713
SMART Domains Protein: ENSMUSP00000120949
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 95 6.73e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152022
Predicted Effect probably damaging
Transcript: ENSMUST00000167240
AA Change: W129R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946
AA Change: W129R

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Meta Mutation Damage Score 0.6837 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Four alternatively spliced transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not undergo spontaneous hemorrhaging but exhibit impaired platelet aggregation, resistance to collagen-induced thrombosis, and increased bleeding times after tail transection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Rasgrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Rasgrp2 APN 19 6404383 missense probably damaging 1.00
IGL03053:Rasgrp2 APN 19 6407332 splice site probably benign
thither UTSW 19 6404727 missense probably damaging 1.00
R1593:Rasgrp2 UTSW 19 6403460 missense possibly damaging 0.77
R1604:Rasgrp2 UTSW 19 6407057 missense possibly damaging 0.62
R2016:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2017:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2119:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2120:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2122:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2124:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R3879:Rasgrp2 UTSW 19 6413890 missense probably benign 0.07
R4049:Rasgrp2 UTSW 19 6404727 missense probably damaging 1.00
R4655:Rasgrp2 UTSW 19 6404846 intron probably benign
R5320:Rasgrp2 UTSW 19 6408834 splice site probably null
R5620:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
R5933:Rasgrp2 UTSW 19 6402513 missense probably damaging 1.00
R6155:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6157:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6867:Rasgrp2 UTSW 19 6413183 missense probably benign 0.00
R7237:Rasgrp2 UTSW 19 6404808 missense possibly damaging 0.79
R7575:Rasgrp2 UTSW 19 6404367 missense probably damaging 0.99
R7659:Rasgrp2 UTSW 19 6401827 missense probably damaging 0.98
R7744:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTCTTGCAGAGCAGAATTTG -3'
(R):5'- AGTCTTAGCCCTTCCTGGAATC -3'

Sequencing Primer
(F):5'- CACAGAGTACGTTGTCCATCAGTG -3'
(R):5'- TTCTCAGCCCACACTGCAC -3'
Posted On2016-07-06