Incidental Mutation 'R5250:Olfr1437'
ID399002
Institutional Source Beutler Lab
Gene Symbol Olfr1437
Ensembl Gene ENSMUSG00000096436
Gene Nameolfactory receptor 1437
SynonymsGA_x6K02T2RE5P-2658227-2657289, MOR214-6
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12319207-12325101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12322066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000146333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052558] [ENSMUST00000207241]
Predicted Effect probably benign
Transcript: ENSMUST00000052558
AA Change: T254A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000056003
Gene: ENSMUSG00000096436
AA Change: T254A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 6.7e-55 PFAM
Pfam:7tm_1 42 291 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207241
AA Change: T254A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.3530 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Olfr1437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03034:Olfr1437 APN 19 12322654 missense possibly damaging 0.79
R0319:Olfr1437 UTSW 19 12322316 nonsense probably null
R1603:Olfr1437 UTSW 19 12321984 missense probably damaging 0.99
R2175:Olfr1437 UTSW 19 12322521 missense probably damaging 0.97
R2907:Olfr1437 UTSW 19 12322668 missense probably damaging 1.00
R5390:Olfr1437 UTSW 19 12322141 missense probably damaging 0.98
R6949:Olfr1437 UTSW 19 12322428 missense probably damaging 1.00
R7437:Olfr1437 UTSW 19 12322108 missense probably damaging 0.99
R7652:Olfr1437 UTSW 19 12322287 missense probably damaging 1.00
Z1176:Olfr1437 UTSW 19 12322267 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTATTAGCAGCATCCCAGCTTC -3'
(R):5'- CATGCCCCAGCTGTTAAATC -3'

Sequencing Primer
(F):5'- AGCAGCATCCCAGCTTCTTCTG -3'
(R):5'- AGCTGTTAAATCTATCCTGCACTGAC -3'
Posted On2016-07-06