Incidental Mutation 'R5174:Vmn2r72'
ID 399004
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Name vomeronasal 2, receptor 72
Synonyms EG244114, Vmn2r72-ps
MMRRC Submission 042754-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5174 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 85386992-85404189 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85387048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 839 (I839L)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
AlphaFold D3Z4N8
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: I839L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I839L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,728,209 (GRCm39) S632P probably damaging Het
Arhgef16 G A 4: 154,366,504 (GRCm39) R451W probably damaging Het
Asxl3 A T 18: 22,656,172 (GRCm39) D1394V probably benign Het
Atp2a3 T A 11: 72,871,041 (GRCm39) I545N probably damaging Het
Cadps2 T A 6: 23,287,742 (GRCm39) Y1181F probably damaging Het
Camkmt C A 17: 85,759,665 (GRCm39) F268L probably benign Het
Casp14 C T 10: 78,551,225 (GRCm39) G20D possibly damaging Het
Celf1 T C 2: 90,831,353 (GRCm39) C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,618,258 (GRCm39) probably null Het
Cers3 A T 7: 66,434,616 (GRCm39) K203M probably damaging Het
Clip4 T C 17: 72,117,957 (GRCm39) F334S probably damaging Het
Cyp2b13 T A 7: 25,788,118 (GRCm39) D415E possibly damaging Het
Decr2 A T 17: 26,306,443 (GRCm39) probably null Het
Dmxl2 T C 9: 54,352,768 (GRCm39) probably null Het
Dnah7b G A 1: 46,282,509 (GRCm39) A2881T possibly damaging Het
Dnaja3 A G 16: 4,502,161 (GRCm39) H55R probably benign Het
Dnajc11 T C 4: 152,064,441 (GRCm39) F531L probably damaging Het
Efcab6 A G 15: 83,938,687 (GRCm39) F10L probably benign Het
Epm2aip1 T C 9: 111,102,455 (GRCm39) F476S probably damaging Het
Fat3 T C 9: 15,910,866 (GRCm39) N1712S probably damaging Het
Flnc T C 6: 29,448,893 (GRCm39) V1343A possibly damaging Het
Fsip2 C T 2: 82,811,085 (GRCm39) P2468L probably benign Het
Gm5798 A G 14: 41,070,620 (GRCm39) H10R possibly damaging Het
Gm7168 A G 17: 14,168,717 (GRCm39) Y28C probably damaging Het
Gtpbp6 G A 5: 110,255,983 (GRCm39) R19C possibly damaging Het
Gucy2e A G 11: 69,127,392 (GRCm39) F27S probably benign Het
Inhca C T 9: 103,159,755 (GRCm39) probably null Het
Krba1 A G 6: 48,389,229 (GRCm39) E548G probably damaging Het
Ltbr A G 6: 125,286,500 (GRCm39) S229P probably benign Het
Mgat5b A T 11: 116,868,541 (GRCm39) Y488F probably benign Het
Mia3 T A 1: 183,112,348 (GRCm39) K475* probably null Het
Mrpl53 C T 6: 83,086,638 (GRCm39) T114M possibly damaging Het
Mrps35 T C 6: 146,961,709 (GRCm39) Y195H possibly damaging Het
Muc4 A T 16: 32,570,556 (GRCm39) I539F possibly damaging Het
Nedd1 T A 10: 92,547,074 (GRCm39) T150S possibly damaging Het
Nox4 T G 7: 86,972,974 (GRCm39) I327S probably benign Het
Nrk C G X: 137,887,528 (GRCm39) A1018G probably benign Het
Or4c102 T A 2: 88,422,992 (GRCm39) N281K probably damaging Het
Or4d5 T C 9: 40,012,043 (GRCm39) T248A possibly damaging Het
Or52ae7 T A 7: 103,119,610 (GRCm39) F121L probably benign Het
Or5w19 T A 2: 87,698,755 (GRCm39) V140E possibly damaging Het
Pdzd2 G A 15: 12,372,600 (GRCm39) P2512S probably benign Het
Ptgis T A 2: 167,045,390 (GRCm39) probably null Het
Rnf170 T A 8: 26,619,196 (GRCm39) M140K probably benign Het
Scaf4 A T 16: 90,044,062 (GRCm39) I637K unknown Het
Sdccag8 A T 1: 176,672,916 (GRCm39) T270S probably damaging Het
Sec24d T C 3: 123,158,575 (GRCm39) C1022R probably damaging Het
Sec63 T C 10: 42,705,077 (GRCm39) probably benign Het
Serpinb3d C G 1: 107,006,228 (GRCm39) E287Q possibly damaging Het
Silc1 A T 12: 27,192,027 (GRCm39) noncoding transcript Het
Smarcd2 A G 11: 106,157,871 (GRCm39) probably benign Het
Sox15 A G 11: 69,546,545 (GRCm39) Y116C probably damaging Het
Spag16 T C 1: 70,532,955 (GRCm39) S545P probably damaging Het
Ssc5d C A 7: 4,930,970 (GRCm39) T184N possibly damaging Het
St6galnac2 A T 11: 116,572,773 (GRCm39) F228I probably damaging Het
Syne1 T C 10: 4,991,490 (GRCm39) N8408S probably damaging Het
Trank1 A C 9: 111,194,627 (GRCm39) T884P probably benign Het
Ubr3 T A 2: 69,839,506 (GRCm39) L1540H probably damaging Het
Ugt2b37 C A 5: 87,399,739 (GRCm39) M256I probably benign Het
Vmn2r69 G A 7: 85,064,739 (GRCm39) T49I possibly damaging Het
Zcrb1 A G 15: 93,285,456 (GRCm39) probably null Het
Zfp319 A T 8: 96,054,797 (GRCm39) probably null Het
Zfp592 T C 7: 80,688,073 (GRCm39) S1000P probably damaging Het
Zfp938 T C 10: 82,061,838 (GRCm39) N261D possibly damaging Het
Zfp957 A G 14: 79,450,828 (GRCm39) S324P unknown Het
Zswim6 G T 13: 107,863,216 (GRCm39) noncoding transcript Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85,398,854 (GRCm39) missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85,387,542 (GRCm39) missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85,398,854 (GRCm39) missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85,387,575 (GRCm39) missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85,387,374 (GRCm39) missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85,387,374 (GRCm39) missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85,387,374 (GRCm39) missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85,399,919 (GRCm39) missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85,387,170 (GRCm39) missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85,399,901 (GRCm39) missense probably benign
IGL02514:Vmn2r72 APN 7 85,387,907 (GRCm39) missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85,387,391 (GRCm39) missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85,387,879 (GRCm39) missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85,401,021 (GRCm39) missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85,401,249 (GRCm39) splice site probably benign
IGL03150:Vmn2r72 APN 7 85,400,384 (GRCm39) missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85,404,162 (GRCm39) missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85,400,075 (GRCm39) missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85,401,044 (GRCm39) missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85,404,084 (GRCm39) missense probably benign
R0655:Vmn2r72 UTSW 7 85,387,319 (GRCm39) nonsense probably null
R0778:Vmn2r72 UTSW 7 85,398,947 (GRCm39) missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85,400,517 (GRCm39) missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85,401,152 (GRCm39) missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85,401,152 (GRCm39) missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85,401,152 (GRCm39) missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85,398,396 (GRCm39) missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85,387,465 (GRCm39) missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85,398,419 (GRCm39) missense probably benign
R1632:Vmn2r72 UTSW 7 85,401,000 (GRCm39) missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85,387,378 (GRCm39) missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85,398,369 (GRCm39) missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85,387,444 (GRCm39) missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85,387,549 (GRCm39) missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85,387,464 (GRCm39) missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85,400,161 (GRCm39) missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85,400,477 (GRCm39) missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85,400,044 (GRCm39) missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85,400,044 (GRCm39) missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85,400,044 (GRCm39) missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85,398,850 (GRCm39) missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85,387,285 (GRCm39) missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85,387,285 (GRCm39) missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85,398,943 (GRCm39) missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85,400,339 (GRCm39) missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85,399,017 (GRCm39) missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85,387,708 (GRCm39) missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85,387,708 (GRCm39) missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85,387,036 (GRCm39) nonsense probably null
R4522:Vmn2r72 UTSW 7 85,401,134 (GRCm39) missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85,401,134 (GRCm39) missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85,401,134 (GRCm39) missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85,387,119 (GRCm39) nonsense probably null
R4781:Vmn2r72 UTSW 7 85,387,069 (GRCm39) missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85,399,806 (GRCm39) missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85,400,317 (GRCm39) missense probably benign
R4991:Vmn2r72 UTSW 7 85,400,338 (GRCm39) missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85,387,693 (GRCm39) missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85,387,061 (GRCm39) missense probably damaging 0.98
R5276:Vmn2r72 UTSW 7 85,387,462 (GRCm39) missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85,400,105 (GRCm39) missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85,401,150 (GRCm39) missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85,387,058 (GRCm39) missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85,387,137 (GRCm39) missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85,387,137 (GRCm39) missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85,399,747 (GRCm39) critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85,400,382 (GRCm39) missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85,398,892 (GRCm39) missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85,387,204 (GRCm39) missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85,399,011 (GRCm39) splice site probably null
R7189:Vmn2r72 UTSW 7 85,404,125 (GRCm39) missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85,387,482 (GRCm39) nonsense probably null
R7323:Vmn2r72 UTSW 7 85,399,771 (GRCm39) missense probably benign
R7426:Vmn2r72 UTSW 7 85,400,348 (GRCm39) missense probably benign
R7606:Vmn2r72 UTSW 7 85,400,362 (GRCm39) missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85,401,146 (GRCm39) missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85,404,098 (GRCm39) missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85,399,834 (GRCm39) missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85,398,838 (GRCm39) missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85,400,441 (GRCm39) missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85,400,227 (GRCm39) missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85,401,168 (GRCm39) missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85,387,383 (GRCm39) missense probably benign
R8989:Vmn2r72 UTSW 7 85,404,134 (GRCm39) missense probably benign 0.10
R9015:Vmn2r72 UTSW 7 85,398,388 (GRCm39) missense probably benign 0.01
R9080:Vmn2r72 UTSW 7 85,387,464 (GRCm39) missense probably damaging 1.00
R9269:Vmn2r72 UTSW 7 85,400,411 (GRCm39) missense probably benign 0.03
R9317:Vmn2r72 UTSW 7 85,404,022 (GRCm39) missense probably benign 0.04
R9509:Vmn2r72 UTSW 7 85,404,075 (GRCm39) missense probably benign
Z1176:Vmn2r72 UTSW 7 85,398,399 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAACAAACTAAGGTCCAGGTC -3'
(R):5'- CTCTTGACATTCAGCATGCTG -3'

Sequencing Primer
(F):5'- AACTAAGGTCCAGGTCATGTTTTTG -3'
(R):5'- ACATTCAGCATGCTGGTGTTC -3'
Posted On 2016-07-06