Incidental Mutation 'R5251:Ankrd16'
ID 399009
Institutional Source Beutler Lab
Gene Symbol Ankrd16
Ensembl Gene ENSMUSG00000047909
Gene Name ankyrin repeat domain 16
Synonyms D430029B21Rik, 2810455F06Rik
MMRRC Submission 042822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R5251 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 11782687-11795140 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11783552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 51 (D51E)
Ref Sequence ENSEMBL: ENSMUSP00000141685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056108] [ENSMUST00000071564] [ENSMUST00000130186] [ENSMUST00000133664] [ENSMUST00000156067]
AlphaFold A2AS55
Predicted Effect probably benign
Transcript: ENSMUST00000056108
AA Change: D51E

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052056
Gene: ENSMUSG00000047909
AA Change: D51E

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 167 1.74e0 SMART
ANK 170 200 7.71e-2 SMART
ANK 204 233 5.01e-1 SMART
ANK 238 268 1.37e2 SMART
ANK 273 302 7.53e-5 SMART
ANK 306 336 4.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071564
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect probably damaging
Transcript: ENSMUST00000130186
AA Change: D51E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141685
Gene: ENSMUSG00000047909
AA Change: D51E

DomainStartEndE-ValueType
ANK 36 66 7.2e-3 SMART
Pfam:Ank 72 90 7.9e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133664
SMART Domains Protein: ENSMUSP00000115226
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
Pfam:Ank 1 29 1.5e-3 PFAM
Pfam:Ank_4 1 51 7.3e-11 PFAM
Pfam:Ank_2 1 56 8.9e-11 PFAM
Pfam:Ank_5 18 56 1.8e-6 PFAM
Pfam:Ank 30 55 3e-5 PFAM
Pfam:Ank_3 30 55 2.7e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150213
Predicted Effect possibly damaging
Transcript: ENSMUST00000156067
AA Change: D51E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115525
Gene: ENSMUSG00000047909
AA Change: D51E

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 165 9.46e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194100
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 36,108,236 (GRCm39) E194V probably damaging Het
Arhgef5 A G 6: 43,249,815 (GRCm39) T189A possibly damaging Het
Camk4 A G 18: 33,317,932 (GRCm39) D363G probably benign Het
Camta1 A G 4: 151,248,341 (GRCm39) I199T probably damaging Het
Ccdc141 C T 2: 76,858,118 (GRCm39) C1021Y probably damaging Het
Cdc34 C T 10: 79,521,090 (GRCm39) S129L probably damaging Het
Cenph T A 13: 100,898,348 (GRCm39) N185I possibly damaging Het
Colq A G 14: 31,261,776 (GRCm39) probably null Het
Dph2 A T 4: 117,747,543 (GRCm39) D280E probably damaging Het
Exosc5 A G 7: 25,367,180 (GRCm39) Y224C probably damaging Het
Fgfr3 C T 5: 33,892,900 (GRCm39) probably benign Het
Hs3st6 T A 17: 24,976,959 (GRCm39) D146E probably benign Het
Igkv13-84 A T 6: 68,916,772 (GRCm39) Q23L probably benign Het
Macf1 A G 4: 123,343,760 (GRCm39) V2154A probably benign Het
Man1a2 T C 3: 100,527,415 (GRCm39) E225G probably damaging Het
Mertk T C 2: 128,571,375 (GRCm39) S110P probably damaging Het
Nav3 A G 10: 109,689,114 (GRCm39) F388L probably damaging Het
Nme8 T C 13: 19,844,795 (GRCm39) N98S probably benign Het
Nup205 A G 6: 35,173,417 (GRCm39) probably null Het
Prl7d1 T C 13: 27,893,227 (GRCm39) N228S probably benign Het
Prss23 T C 7: 89,159,530 (GRCm39) K180E probably damaging Het
Psap G A 10: 60,137,479 (GRCm39) D549N probably damaging Het
Sec16a A G 2: 26,329,357 (GRCm39) V886A probably benign Het
Sh2d1b2 A T 1: 170,077,642 (GRCm39) E81D probably benign Het
Tbx6 A T 7: 126,382,516 (GRCm39) N254I probably damaging Het
Tchhl1 T C 3: 93,377,860 (GRCm39) V188A possibly damaging Het
Trpc3 A T 3: 36,725,103 (GRCm39) L291Q probably damaging Het
Zbtb38 G T 9: 96,569,161 (GRCm39) T641N probably benign Het
Other mutations in Ankrd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Ankrd16 APN 2 11,783,473 (GRCm39) missense probably damaging 1.00
R0280:Ankrd16 UTSW 2 11,786,312 (GRCm39) missense probably damaging 1.00
R0521:Ankrd16 UTSW 2 11,794,692 (GRCm39) missense probably benign
R1441:Ankrd16 UTSW 2 11,783,557 (GRCm39) missense probably damaging 1.00
R1699:Ankrd16 UTSW 2 11,789,204 (GRCm39) missense probably benign
R1858:Ankrd16 UTSW 2 11,783,407 (GRCm39) missense probably benign
R1944:Ankrd16 UTSW 2 11,788,443 (GRCm39) splice site probably null
R2074:Ankrd16 UTSW 2 11,794,559 (GRCm39) missense possibly damaging 0.82
R2104:Ankrd16 UTSW 2 11,784,711 (GRCm39) intron probably benign
R2131:Ankrd16 UTSW 2 11,788,506 (GRCm39) missense probably damaging 1.00
R3847:Ankrd16 UTSW 2 11,794,619 (GRCm39) missense probably benign 0.04
R3940:Ankrd16 UTSW 2 11,789,192 (GRCm39) missense probably benign
R4424:Ankrd16 UTSW 2 11,789,215 (GRCm39) missense possibly damaging 0.95
R4707:Ankrd16 UTSW 2 11,783,608 (GRCm39) missense probably damaging 1.00
R4863:Ankrd16 UTSW 2 11,789,127 (GRCm39) missense probably benign 0.05
R5026:Ankrd16 UTSW 2 11,794,692 (GRCm39) missense probably benign 0.05
R5079:Ankrd16 UTSW 2 11,783,710 (GRCm39) missense probably damaging 1.00
R5304:Ankrd16 UTSW 2 11,794,545 (GRCm39) missense probably benign
R5746:Ankrd16 UTSW 2 11,789,178 (GRCm39) missense probably damaging 0.99
R6932:Ankrd16 UTSW 2 11,791,054 (GRCm39) missense possibly damaging 0.90
R6958:Ankrd16 UTSW 2 11,784,604 (GRCm39) missense probably damaging 1.00
R9228:Ankrd16 UTSW 2 11,786,318 (GRCm39) missense probably benign 0.00
R9259:Ankrd16 UTSW 2 11,784,532 (GRCm39) missense probably damaging 0.98
Z1088:Ankrd16 UTSW 2 11,784,629 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGACTGAACCTGGGTCTTCC -3'
(R):5'- CGATATAGCTTTTCTGGACCGTG -3'

Sequencing Primer
(F):5'- GAACCTGGGTCTTCCTCCTAC -3'
(R):5'- GACCGTGGGTTGGGCAC -3'
Posted On 2016-07-06