Mutagenetix > Incidental Mutation

Incidental Mutation 'R5251:Mertk'

399012

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

042822-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R5251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128729455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 110 (S110P)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: S110P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: S110P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1	A	T	5: 35,950,892	E194V	probably damaging	Het
Ankrd16	T	A	2: 11,778,741	D51E	probably damaging	Het
Arhgef5	A	G	6: 43,272,881	T189A	possibly damaging	Het
Camk4	A	G	18: 33,184,879	D363G	probably benign	Het
Camta1	A	G	4: 151,163,884	I199T	probably damaging	Het
Ccdc141	C	T	2: 77,027,774	C1021Y	probably damaging	Het
Cdc34	C	T	10: 79,685,256	S129L	probably damaging	Het
Cenph	T	A	13: 100,761,840	N185I	possibly damaging	Het
Colq	A	G	14: 31,539,819		probably null	Het
Dph2	A	T	4: 117,890,346	D280E	probably damaging	Het
Exosc5	A	G	7: 25,667,755	Y224C	probably damaging	Het
Fgfr3	C	T	5: 33,735,556		probably benign	Het
Hs3st6	T	A	17: 24,757,985	D146E	probably benign	Het
Igkv13-84	A	T	6: 68,939,788	Q23L	probably benign	Het
Macf1	A	G	4: 123,449,967	V2154A	probably benign	Het
Man1a2	T	C	3: 100,620,099	E225G	probably damaging	Het
Nav3	A	G	10: 109,853,253	F388L	probably damaging	Het
Nme8	T	C	13: 19,660,625	N98S	probably benign	Het
Nup205	A	G	6: 35,196,482		probably null	Het
Prl7d1	T	C	13: 27,709,244	N228S	probably benign	Het
Prss23	T	C	7: 89,510,322	K180E	probably damaging	Het
Psap	G	A	10: 60,301,700	D549N	probably damaging	Het
Sec16a	A	G	2: 26,439,345	V886A	probably benign	Het
Sh2d1b2	A	T	1: 170,250,073	E81D	probably benign	Het
Tbx6	A	T	7: 126,783,344	N254I	probably damaging	Het
Tchhl1	T	C	3: 93,470,553	V188A	possibly damaging	Het
Trpc3	A	T	3: 36,670,954	L291Q	probably damaging	Het
Zbtb38	G	T	9: 96,687,108	T641N	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128762109	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128751960	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128782607	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128801335	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTTCAGGGCCTTTACCAGGG -3'
(R):5'- ACTAGAGGATTCTGCTTTGGAG -3'

Sequencing Primer
(F):5'- GTCAACCACAGGCCATTCTCTG -3'
(R):5'- GGAGGTGGTATTAGCATAATGGC -3'

Posted On

2016-07-06