Incidental Mutation 'R5251:Trpc3'
ID399014
Institutional Source Beutler Lab
Gene Symbol Trpc3
Ensembl Gene ENSMUSG00000027716
Gene Nametransient receptor potential cation channel, subfamily C, member 3
SynonymsTrp3, Trrp3, Trcp3
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36620482-36690167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36670954 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 291 (L291Q)
Ref Sequence ENSEMBL: ENSMUSP00000029271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029271]
Predicted Effect probably damaging
Transcript: ENSMUST00000029271
AA Change: L291Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029271
Gene: ENSMUSG00000027716
AA Change: L291Q

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 47 68 N/A INTRINSIC
ANK 100 129 2.47e2 SMART
ANK 135 163 1.97e1 SMART
ANK 221 250 1.13e1 SMART
Pfam:TRP_2 256 318 3e-28 PFAM
transmembrane domain 414 433 N/A INTRINSIC
Pfam:Ion_trans 443 744 4.4e-34 PFAM
Pfam:PKD_channel 486 739 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146475
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous knockout mice or mice heterozygoous for a point mutation in exon 7 display an abnormal gait. Abnormal nervous system electrophysiology is also described. An A1903G point mutation in exon 7 results in homozygous lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Trpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Trpc3 APN 3 36640639 missense possibly damaging 0.95
IGL01701:Trpc3 APN 3 36671594 missense possibly damaging 0.92
IGL02254:Trpc3 APN 3 36651520 missense probably null 0.98
IGL02723:Trpc3 APN 3 36650228 missense probably benign 0.02
IGL02816:Trpc3 APN 3 36651702 missense probably damaging 1.00
IGL02867:Trpc3 APN 3 36640701 missense probably benign 0.10
IGL02929:Trpc3 APN 3 36638474 nonsense probably null
IGL03076:Trpc3 APN 3 36640655 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0115:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0481:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0645:Trpc3 UTSW 3 36671505 missense probably benign 0.00
R0694:Trpc3 UTSW 3 36671555 missense possibly damaging 0.48
R1190:Trpc3 UTSW 3 36671348 missense probably benign 0.00
R1635:Trpc3 UTSW 3 36640627 missense probably damaging 1.00
R1828:Trpc3 UTSW 3 36638546 missense possibly damaging 0.95
R2204:Trpc3 UTSW 3 36650149 missense possibly damaging 0.79
R2937:Trpc3 UTSW 3 36634383 nonsense probably null
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3733:Trpc3 UTSW 3 36638559 missense probably benign
R4063:Trpc3 UTSW 3 36671023 missense probably damaging 1.00
R4270:Trpc3 UTSW 3 36662925 nonsense probably null
R4807:Trpc3 UTSW 3 36634382 missense probably benign 0.00
R4996:Trpc3 UTSW 3 36662818 missense probably benign 0.00
R5098:Trpc3 UTSW 3 36662898 missense probably benign 0.07
R5139:Trpc3 UTSW 3 36671557 missense possibly damaging 0.46
R5337:Trpc3 UTSW 3 36638370 intron probably benign
R5891:Trpc3 UTSW 3 36671022 missense probably damaging 1.00
R6512:Trpc3 UTSW 3 36662758 missense possibly damaging 0.59
R6618:Trpc3 UTSW 3 36640695 missense possibly damaging 0.82
R6750:Trpc3 UTSW 3 36624393 missense probably damaging 1.00
R6950:Trpc3 UTSW 3 36638590 missense probably damaging 1.00
R6986:Trpc3 UTSW 3 36655016 critical splice donor site probably null
R7031:Trpc3 UTSW 3 36621310 missense probably benign
R7100:Trpc3 UTSW 3 36650067 missense probably benign 0.00
R7182:Trpc3 UTSW 3 36655109 missense probably benign 0.02
R7211:Trpc3 UTSW 3 36640733 missense possibly damaging 0.81
R7214:Trpc3 UTSW 3 36650137 missense possibly damaging 0.94
R7284:Trpc3 UTSW 3 36624413 missense probably damaging 0.98
R7468:Trpc3 UTSW 3 36624416 missense probably damaging 0.99
R7652:Trpc3 UTSW 3 36638528 missense probably benign 0.06
R7815:Trpc3 UTSW 3 36655145 missense probably benign 0.28
R7833:Trpc3 UTSW 3 36640672 missense probably damaging 0.96
R7916:Trpc3 UTSW 3 36640672 missense probably damaging 0.96
Z1177:Trpc3 UTSW 3 36621279 missense not run
Predicted Primers PCR Primer
(F):5'- ACCCTAGGACTCTGTCTAAACCAG -3'
(R):5'- TGCCATAAGTACGAGGTGGTG -3'

Sequencing Primer
(F):5'- GTAGCATGGTCTTGTAAACCCAGC -3'
(R):5'- GCACCTGCTGCTACTCAAG -3'
Posted On2016-07-06