Incidental Mutation 'R5251:Tchhl1'
ID399017
Institutional Source Beutler Lab
Gene Symbol Tchhl1
Ensembl Gene ENSMUSG00000027908
Gene Nametrichohyalin-like 1
SynonymsThhl1, S100a17
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93468754-93471980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93470553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000029516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029516
AA Change: V188A

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: V188A

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-15 PFAM
low complexity region 111 124 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Tchhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tchhl1 APN 3 93470923 missense probably benign 0.00
IGL00803:Tchhl1 APN 3 93470900 missense probably benign 0.00
IGL01075:Tchhl1 APN 3 93470316 missense probably damaging 1.00
IGL01814:Tchhl1 APN 3 93470349 missense possibly damaging 0.53
IGL02026:Tchhl1 APN 3 93470555 missense probably damaging 0.99
IGL02407:Tchhl1 APN 3 93471327 missense possibly damaging 0.95
IGL03286:Tchhl1 APN 3 93471123 missense probably benign 0.00
IGL03293:Tchhl1 APN 3 93470275 missense probably damaging 1.00
Reef UTSW 3 93471029 nonsense probably null
R0371:Tchhl1 UTSW 3 93469577 missense probably damaging 1.00
R0403:Tchhl1 UTSW 3 93471029 nonsense probably null
R0763:Tchhl1 UTSW 3 93471571 missense probably benign 0.05
R1052:Tchhl1 UTSW 3 93470213 missense probably benign 0.32
R1848:Tchhl1 UTSW 3 93471101 missense probably damaging 1.00
R4917:Tchhl1 UTSW 3 93470316 missense possibly damaging 0.52
R4918:Tchhl1 UTSW 3 93470316 missense possibly damaging 0.52
R4945:Tchhl1 UTSW 3 93471576 missense probably benign 0.00
R5260:Tchhl1 UTSW 3 93470795 missense probably damaging 1.00
R5398:Tchhl1 UTSW 3 93471603 missense probably benign 0.01
R5759:Tchhl1 UTSW 3 93471556 missense probably damaging 1.00
R5760:Tchhl1 UTSW 3 93471556 missense probably damaging 1.00
R5872:Tchhl1 UTSW 3 93470529 missense probably benign 0.31
R6592:Tchhl1 UTSW 3 93470809 missense probably damaging 0.99
R7464:Tchhl1 UTSW 3 93470664 missense probably benign 0.01
R7653:Tchhl1 UTSW 3 93471144 missense probably benign 0.01
R7726:Tchhl1 UTSW 3 93471758 missense probably benign 0.07
RF018:Tchhl1 UTSW 3 93470384 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGTGGAAACATTCAGCAGG -3'
(R):5'- GTTGGCCTCTGAATCATATGGTC -3'

Sequencing Primer
(F):5'- CAAGAAAGGCTCATATTTCCATCAG -3'
(R):5'- ATATGGTCACTTATCTTGGTGTCAC -3'
Posted On2016-07-06