Incidental Mutation 'R5251:Dph2'
ID399021
Institutional Source Beutler Lab
Gene Symbol Dph2
Ensembl Gene ENSMUSG00000028540
Gene NameDPH2 homolog
Synonyms9130020C19Rik, Dph2l2
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117888643-117892032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117890346 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 280 (D280E)
Ref Sequence ENSEMBL: ENSMUSP00000030265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030265] [ENSMUST00000036156] [ENSMUST00000036380] [ENSMUST00000132073] [ENSMUST00000136596] [ENSMUST00000147845] [ENSMUST00000149868] [ENSMUST00000150204] [ENSMUST00000183773]
Predicted Effect probably damaging
Transcript: ENSMUST00000030265
AA Change: D280E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030265
Gene: ENSMUSG00000028540
AA Change: D280E

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 54 375 2.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036156
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036380
SMART Domains Protein: ENSMUSP00000047682
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:ATP-synt_C 50 112 1.2e-15 PFAM
Pfam:ATP-synt_C 136 198 1.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128263
Predicted Effect probably benign
Transcript: ENSMUST00000132073
SMART Domains Protein: ENSMUSP00000137654
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 1.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134752
Predicted Effect probably benign
Transcript: ENSMUST00000136596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140661
Predicted Effect probably benign
Transcript: ENSMUST00000147845
Predicted Effect probably benign
Transcript: ENSMUST00000149868
SMART Domains Protein: ENSMUSP00000137788
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 3.1e-19 PFAM
transmembrane domain 84 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150204
SMART Domains Protein: ENSMUSP00000119988
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 8.2e-19 PFAM
Pfam:ATP-synt_C 88 152 1.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155524
Predicted Effect probably benign
Transcript: ENSMUST00000183773
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human genes similar to the yeast gene dph2. The yeast gene was identified by its ability to complement a diphthamide mutant strain, and thus probably functions in diphthamide biosynthesis. Diphthamide is a post-translationally modified histidine residue present in elongation factor 2 (EF2) that is the target of diphtheria toxin ADP-ribosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Dph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0295:Dph2 UTSW 4 117890930 missense possibly damaging 0.96
R1381:Dph2 UTSW 4 117889668 missense probably damaging 1.00
R1958:Dph2 UTSW 4 117891844 missense probably damaging 1.00
R4959:Dph2 UTSW 4 117891330 missense probably damaging 1.00
R4973:Dph2 UTSW 4 117891330 missense probably damaging 1.00
R6982:Dph2 UTSW 4 117889796 missense probably benign
R7383:Dph2 UTSW 4 117891369 missense probably damaging 1.00
R7658:Dph2 UTSW 4 117890281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCGTCAATACAGGCCGAAAG -3'
(R):5'- TTCTCAAGCAAGCTCGGACTC -3'

Sequencing Primer
(F):5'- CCCAGGGGACAGGCTAACAG -3'
(R):5'- AAGCTCGGACTCCAGCCTTG -3'
Posted On2016-07-06