Incidental Mutation 'R5251:Camta1'
ID399025
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151163884 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 199 (I199T)
Ref Sequence ENSEMBL: ENSMUSP00000127916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000169423]
Predicted Effect probably damaging
Transcript: ENSMUST00000049790
AA Change: I199T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: I199T

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097774
AA Change: I199T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: I199T

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169423
AA Change: I199T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: I199T

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,950,892 E194V probably damaging Het
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1704:Camta1 UTSW 4 151075224 missense probably damaging 1.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2081:Camta1 UTSW 4 151144242 missense probably benign 0.24
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151084812 missense probably benign 0.03
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5388:Camta1 UTSW 4 151075238 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7264:Camta1 UTSW 4 151453399 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
R7585:Camta1 UTSW 4 151144830 missense probably damaging 1.00
R7881:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R7964:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R8057:Camta1 UTSW 4 151144032 missense not run
R8073:Camta1 UTSW 4 151078824 missense not run
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151144385 missense not run
Z1177:Camta1 UTSW 4 151077925 missense not run
Predicted Primers PCR Primer
(F):5'- TTAAGTGACCACAGGCATCG -3'
(R):5'- CAAATGCTATCACCTGGATCCAG -3'

Sequencing Primer
(F):5'- GGGGATGTCATTAAGGCTAAATTCAC -3'
(R):5'- TGCTATCACCTGGATCCAGCATAG -3'
Posted On2016-07-06