Incidental Mutation 'R5251:Afap1'
ID399029
Institutional Source Beutler Lab
Gene Symbol Afap1
Ensembl Gene ENSMUSG00000029094
Gene Nameactin filament associated protein 1
Synonyms
MMRRC Submission 042822-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R5251 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35893319-36003923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35950892 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 194 (E194V)
Ref Sequence ENSEMBL: ENSMUSP00000119364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064571] [ENSMUST00000141824]
Predicted Effect probably damaging
Transcript: ENSMUST00000064571
AA Change: E194V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067779
Gene: ENSMUSG00000029094
AA Change: E194V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:PH 21 110 9e-9 BLAST
low complexity region 112 130 N/A INTRINSIC
PH 153 250 2.26e-12 SMART
low complexity region 314 335 N/A INTRINSIC
PH 349 444 3.48e-13 SMART
coiled coil region 557 649 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141824
AA Change: E194V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119364
Gene: ENSMUSG00000029094
AA Change: E194V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:PH 21 110 7e-9 BLAST
low complexity region 112 130 N/A INTRINSIC
PH 153 250 2.26e-12 SMART
low complexity region 314 335 N/A INTRINSIC
PH 349 444 3.48e-13 SMART
coiled coil region 557 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Src binding partner. It may represent a potential modulator of actin filament integrity in response to cellular signals, and may function as an adaptor protein by linking Src family members and/or other signaling proteins to actin filaments. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit inability to nurse pups due to failed secretory activation, reduced milk lipid synthesis and precocious mammary gland involution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd16 T A 2: 11,778,741 D51E probably damaging Het
Arhgef5 A G 6: 43,272,881 T189A possibly damaging Het
Camk4 A G 18: 33,184,879 D363G probably benign Het
Camta1 A G 4: 151,163,884 I199T probably damaging Het
Ccdc141 C T 2: 77,027,774 C1021Y probably damaging Het
Cdc34 C T 10: 79,685,256 S129L probably damaging Het
Cenph T A 13: 100,761,840 N185I possibly damaging Het
Colq A G 14: 31,539,819 probably null Het
Dph2 A T 4: 117,890,346 D280E probably damaging Het
Exosc5 A G 7: 25,667,755 Y224C probably damaging Het
Fgfr3 C T 5: 33,735,556 probably benign Het
Hs3st6 T A 17: 24,757,985 D146E probably benign Het
Igkv13-84 A T 6: 68,939,788 Q23L probably benign Het
Macf1 A G 4: 123,449,967 V2154A probably benign Het
Man1a2 T C 3: 100,620,099 E225G probably damaging Het
Mertk T C 2: 128,729,455 S110P probably damaging Het
Nav3 A G 10: 109,853,253 F388L probably damaging Het
Nme8 T C 13: 19,660,625 N98S probably benign Het
Nup205 A G 6: 35,196,482 probably null Het
Prl7d1 T C 13: 27,709,244 N228S probably benign Het
Prss23 T C 7: 89,510,322 K180E probably damaging Het
Psap G A 10: 60,301,700 D549N probably damaging Het
Sec16a A G 2: 26,439,345 V886A probably benign Het
Sh2d1b2 A T 1: 170,250,073 E81D probably benign Het
Tbx6 A T 7: 126,783,344 N254I probably damaging Het
Tchhl1 T C 3: 93,470,553 V188A possibly damaging Het
Trpc3 A T 3: 36,670,954 L291Q probably damaging Het
Zbtb38 G T 9: 96,687,108 T641N probably benign Het
Other mutations in Afap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Afap1 APN 5 35968708 missense probably damaging 0.99
IGL01730:Afap1 APN 5 35962239 missense probably damaging 1.00
IGL01798:Afap1 APN 5 35935682 critical splice donor site probably null
IGL02188:Afap1 APN 5 35936077 missense probably benign 0.00
IGL03027:Afap1 APN 5 35961750 missense probably benign 0.00
R0124:Afap1 UTSW 5 35945209 missense probably damaging 1.00
R0485:Afap1 UTSW 5 35951003 missense probably damaging 0.99
R0532:Afap1 UTSW 5 35968600 missense possibly damaging 0.86
R0891:Afap1 UTSW 5 35961852 splice site probably null
R1370:Afap1 UTSW 5 35935600 missense unknown
R1378:Afap1 UTSW 5 35968686 missense probably damaging 1.00
R1443:Afap1 UTSW 5 35968661 missense probably damaging 1.00
R1470:Afap1 UTSW 5 35961737 splice site probably benign
R1536:Afap1 UTSW 5 35974491 missense probably damaging 1.00
R2357:Afap1 UTSW 5 35984274 missense probably damaging 1.00
R4737:Afap1 UTSW 5 35961782 missense probably benign 0.03
R5918:Afap1 UTSW 5 35974525 missense possibly damaging 0.60
R5936:Afap1 UTSW 5 35974396 missense possibly damaging 0.67
R6008:Afap1 UTSW 5 35997551 missense probably damaging 0.99
R6009:Afap1 UTSW 5 35997560 missense probably damaging 1.00
R6155:Afap1 UTSW 5 35935609 missense unknown
R7058:Afap1 UTSW 5 35962260 missense probably benign 0.00
R7320:Afap1 UTSW 5 35948223 missense probably damaging 0.98
R7799:Afap1 UTSW 5 35974398 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCCGACTTAGCATACACCTG -3'
(R):5'- GTGTCTCAGAGTCATGTCAGATG -3'

Sequencing Primer
(F):5'- TAGGCAGCAGACGGTGTC -3'
(R):5'- AGAGTCATGTCAGATGTCCTACC -3'
Posted On2016-07-06